Targeting ZMYND8 unleashes IL-2 signalling to override T cell exhaustion

Nature作者:Yan Wang2026年9月23日正文已收录本站

Main

Persistent antigen exposure in chronic infection and cancer induces an exhausted program orchestrated by the transcription factor TOX in CD8+ T cells4,5,6,7,8, which is a barrier for immunotherapies. Such hypofunctional programming is associated with progressively decreased expression of the high-affinity IL-2 receptor subunit IL-2Rα (also known as CD25), leading to intermittent IL-2 engagement and suboptimal STAT5 activation that promote exhaustion2. The mechanisms underlying this impaired IL-2Rα expression are largely unknown, so it remains unclear how to engage high-affinity IL-2R signalling and reinvigorate exhausted T cell (Tex) effector function for antiviral and antitumour immunity.

Epigenetic remodelling contributes to Tex heterogeneity, with Tex subpopulations exhibiting distinct epigenetic states and differential responses to immune checkpoint blockade (ICB)1,3. Progenitor exhausted T cells (Texprog cells) respond to ICB by transiently developing into effector-like cells with increased cytotoxic function and later convert to terminally exhausted T cells (Texterm cells)9,10,11. Effector-like cells comprise intermediate exhausted T cell (Texint cell) and killer cell lectin-like receptor (KLR)-expressing T cell (TexKLR cell) subpopulations, with TexKLR cells displaying the strongest cytolytic activity12,13. Uncovering mechanisms that promote effector-like cell accumulation or redirect differentiation into TexKLR over Texterm states may unleash protective immunity against chronic infection and tumours.

Tex epigenetic gene regulatory networks

To identify epigenetic regulators underlying Tex heterogeneity, we applied complementary in vivo single-cell CRISPR (scCRISPR) and bulk CRISPR screens in Cas9-expressing P14 cells, which are antigen-specific CD8+ T cells that respond to chronic lymphocytic choriomeningitis virus (LCMV) clone 13 (Cl13) infection. Considering cell coverage limitations14, we designed a single guide RNA (sgRNA) library based on analysis of public datasets11,15,16 (Extended Data Fig. 1a), resulting in a total of 91 epigenetic factors. Nine transcription factors known to regulate Tex differentiation were also included in the library (Supplementary Table 1), which contained 3 sgRNAs per gene and 30 non-targeting control sgRNAs (sgNTCs) (Supplementary Table 2). Library-transduced P14 cells (Ametrine+) were transferred into Cas9+ mice, followed by LCMV Cl13 infection and analysis at 28 days post-infection (dpi) (Fig. 1a). Of the 330 total sgRNAs in the library, 326 were detected in the scCRISPR screen (Extended Data Fig. 1b). Known positive (for example, Batf17,18,19) and negative (for example, Carm120) regulators of T cell accumulation were captured (Extended Data Fig. 1c).

Fig. 1: In vivo CRISPR screens identify epigenetic regulatory network of CD8+ T cell exhaustion and IL-2R–STAT5 signalling.

a, Experimental schematic for CRISPR screening strategy. Created in BioRender; Wang, Y. https://BioRender.com/3jr1r24 (2026). b, Left, UMAP plot depicting the four Tex states. Right, pseudotime analysis (depicted on UMAP) of the predicted developmental trajectory (starting from Texprog cells). c, Top left, relative log2-transformed fold change (FC) of the effect on gene expression profiles (columns) caused by perturbation of each gene (rows) in P14 cells. Bottom left, Spearman correlation coefficient between the gene programs based on their regulation by perturbations. Top right, Spearman correlation coefficient between the perturbed genes based on their regulation of the downstream gene programs. Co-functional modules (M1–M9) and co-regulated gene programs (G1–G4) were identified by hierarchical clustering of the top right and bottom left matrices, and clustering defined the row and column order. d, Activity scores of co-regulated gene programs (G1–G4) on UMAPs. The dashed lines depict the clusters containing the cell states shown in b. e, Regulatory connections between the top five (ranked by perturbation effects on the four co-regulated gene programs) perturbation modules and four gene programs. Red and blue lines indicate positive and negative regulatory effects, respectively. f–h, Rank plots were generated based on perturbation effects in scCRISPR screening to depict the top positive (blue bars) and negative (red bars) regulators of effector-like (including Texint and TexKLR) states compared with all other states (f), TexKLR compared with Texterm states (g), or the activity score of a STAT5CA Up signature (curated from GSE214116) (h). i, GSEA enrichment plots showing upregulation of STAT5CA Up signature (top) and downregulation of STAT5CA Down signature (bottom) in sgZmynd8-expressing compared with sgNTC-expressing P14 cells. FDR, false discovery rate; NES, normalized enrichment score.

We visualized single-cell transcriptome data using uniform manifold approximation and projection (UMAP) plots. Four clusters were identified and annotated as Texprog, Texint, TexKLR and Texterm clusters based on their signatures (Extended Data Fig. 1d–f). Flow cytometry analysis revealed that TexKLR cells exhibited the highest expression of IFNγ (but not TNF), GZMA, GZMB and perforin (Extended Data Fig. 1g). Additionally, pseudotime analysis revealed a differentiation trajectory originating from Texprog cells, which progressed through the Texint state before diverging towards either the TexKLR or Texterm state (Fig. 1b).

We next explored how epigenetic factors regulate gene programs in Tex cells (Methods). This analysis identified nine co-functional modules (M1–M9; Fig. 1c and Supplementary Table 3) exhibiting differential regulatory effects, along with four co-regulated gene programs (G1–G4; Fig. 1c and Supplementary Table 4) that displayed unique molecular signatures (Extended Data Fig. 1h) and distributions on UMAP (Fig. 1d). We visualized the regulatory strength of each co-functional module on the four gene programs (Extended Data Fig. 1i) and highlighted the top five co-functional modules based on their regulatory effects (Fig. 1e). Two co-functional modules, M3 and M8, showed the strongest perturbation effects on these gene programs (Extended Data Fig. 1i). M3 promoted stemness-associated program G1 and exhaustion-associated program G4, but suppressed proliferation-associated program G2 and effector function-associated program G3 (Fig. 1e). By contrast, M8 suppressed G1 and G4 but promoted G2 and G3 (Fig. 1e), suggesting that M3 and M8 may antagonize each other in shaping downstream gene programs. Additionally, Zmynd8 and Hdac4 from M3 and Ep300 (encoding p300) from M8 represented putative positive and negative regulators of Tox expression, respectively (Extended Data Fig. 1j). Together, these results reveal effects of distinct co-functional modules on orchestrating gene programs and Tox expression in Tex cells.

IL-2 signalling and ZMYND8 in Tex states

During chronic infection, P14 cells displayed low Il2ra expression, especially compared to Il2rb (Extended Data Fig. 1e). Furthermore, Il2ra expression and CD25+ cells, together with CD122 surface levels, were progressively decreased (Extended Data Fig. 1k,l), suggesting that Tex cells receive suboptimal IL-2 signals at later stages of chronic infection. To test the contribution of IL-2 signalling, we performed another scCRISPR screen targeting regulators of IL-2 signalling in chronic infection. Loss of positive regulators of IL-2 signalling (JAK3 or STAT5A and STAT5B) reduced numbers of effector-like and total P14 cells (Extended Data Fig. 1m,n and Supplementary Table 5). By contrast, targeting negative regulators of IL-2 signalling (SOCS1 and SOCS3) increased accumulation of effector-like and total P14 cells (Extended Data Fig. 1m,n). Therefore, negative regulators of IL-2 signalling represent putative targets for enhancing the formation of effector-like states.

We next focused on putative epigenetic factors that suppress effector-like states in scCRISPR screening (Fig. 1f,g and Extended Data Fig. 1o–q). Notably, Zmynd8 was among the top-ranked negative regulators of effector-like cells (Fig. 1f) and positive regulators of Texterm cells (Extended Data Fig. 1p and Supplementary Tables 6 and 7), with enrichment of the Texint or TexKLR versus Texterm state observed in cells expressing sgRNAs targeting Zmynd8 (sgZmynd8) (Fig. 1g and Extended Data Fig. 1q). Similarly, in bulk CRISPR screening, Zmynd8 was the top-ranked negative regulator of effector-like relative to Texterm cells, whereas Zmynd8 was the top-ranked positive regulator of Texterm cells (Extended Data Fig. 1r,s and Supplementary Table 6), suggesting that ZMYND8 suppresses effector-like but promotes Texterm cell accumulation during chronic infection.

ZMYND8 was also the top-ranked negative regulator of STAT5 activity (Fig. 1h). Gene set enrichment analysis (GSEA) revealed that a STAT5 constitutively active (STAT5CA) Up signature21 was increased in ZMYND8-deficient cells, whereas a STAT5CA Down signature21 was decreased (Fig. 1i). Moreover, sgZmynd8-expressing cells were enriched in Texint and TexKLR states, with sgZmynd8 and STAT5CA Up signature activity overlapping in the Texint and TexKLR clusters (Extended Data Fig. 1t–v). Similarly, individual sgRNAs targeting Zmynd8 were enriched in the TexKLR versus Texterm state (Extended Data Fig. 1w,x and Supplementary Table 7). Collectively, ZMYND8 deficiency increases effector-like cell while dampening Texterm formation, and is associated with enhanced STAT5 activity.

ZMYND8 impedes effector-like state

To establish the role of ZMYND8 in Tex heterogeneity, we performed single-cell RNA-sequencing (scRNA-seq) analysis of P14 cells from a dual-colour transfer system19,22 (Extended Data Fig. 2a). ZMYND8-deficient P14 cells showed a selective accumulation of Texint and TexKLR states (Fig. 2a,b and Extended Data Fig. 2b), corresponding to enrichment of an effector-like gene signature10 (Extended Data Fig. 2c). Furthermore, effector-associated genes (Cx3cr1, Gzmb and Zeb2) and natural killer (NK) cell-associated receptor genes (Klrd1, Klre1, Klrg1 and Klrk1) were increased in ZMYND8-deficient P14 cells, whereas exhaustion-related genes (Tox, Tox2 and Cxcr6) were reduced (Extended Data Fig. 2d), suggesting that ZMYND8 deficiency boosts effector and reduces exhaustion-associated features.

Fig. 2: ZMYND8 deficiency promotes TexKLR cell differentiation and antiviral immunity.

a,b, UMAP depicting the Tex states and the density of sgNTC or sgZmynd8-expressing cells (a), and relative proportions of Tex states (b). c,d, Relative frequencies (normalized to co-transferred spike cells) and numbers of effector-like and Texterm cells (n = 7 per group) (c) or TexKLR cells (n = 9 per group) (d) among P14 cells at 21 dpi (dual-colour transfer system). e,f, Tex subpopulations derived from the secondary transfer of Texprog (e) or effector-like (f) cells (n = 6 per group). ND, not detected. g, Specific lysis of target cells ex vivo mediated by indicated P14 cell subpopulations (n = 8 per group). h, Target cell killing in vivo based on frequency of gp33-pulsed splenocytes (CTVlow) at 3 h post-adoptive transfer (n = 5 per group). CTV, Cell Trace Violet. i, Activity score of STAT5CA Up signature in P14 cells on UMAP. j, LCMV-infected mice that received sgNTC or sgZmynd8 (Ametrine+)-expressing P14 cells were treated with PBS or IL-2, followed by adoptive transfer of PBS- or gp33-pulsed splenocytes to assess in vivo killing at 36 dpi. Frequency of gp33-pulsed splenocytes (CTVlow) at 3 h post-adoptive transfer (n = 5 per group). k–m, Texterm (k), effector-like (l) or TexKLR (m) cells at 36 dpi in recipient mice treated as in j (n = 5 per group). Data are pooled from two (c,d,g) or are representative of three (e,f,h,k–m) or two (j) independent experiments. The sgNTC and sgZmynd8 groups in d include one experimental cohort shared with Extended Data Fig. 8i. Data are presented as mean ± s.e.m. (c–h,j–m). Two-tailed unpaired Student’s t-test (c–h) or two-way analysis of variance (ANOVA) (j–m). NS, not significant; *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001.

Source data

Flow cytometry analysis validated that ZMYND8 deficiency increased numbers of effector-like cells and reduced Texterm cells at multiple time points after infection (Fig. 2c and Extended Data Fig. 2e–i). Texprog numbers were also modestly reduced at 21 and 28 dpi (but not at 90 dpi) (Extended Data Fig. 2j–l). Although ZMYND8 deficiency increased Ki-67 expression and reduced the frequency of active caspase-3+ cells among total P14 cells (corresponding to their increased accumulation), Ki-67 expression was largely unaltered in ZMYND8-deficient Tex subpopulations (Extended Data Fig. 2m–o). By contrast, the frequency of active caspase-3+ cells among ZMYND8-deficient effector-like cells was modestly reduced (Extended Data Fig. 2n), indicating that increased cell survival is likely to contribute to accumulation of effector-like cells upon ZMYND8 deletion.

We compared the cellular effects of the three independent sgRNAs targeting Zmynd8 and found that P14 cells expressing sgZmynd8.g1 and sgZmynd8.g2 showed marked increases in numbers of effector-like cells and reductions in Texprog and Texterm cells, with sgZmynd8.g3 exerting similar, albeit less pronounced, effects (Extended Data Fig. 2p,q), in line with its less potent deletion efficiency (Extended Data Fig. 1x and Supplementary Table 7). Also, we targeted Zmynd8 in naive P14 cells by delivering sgRNA with Cas9 ribonucleoproteins (RNPs) (Cas9-RNP) via electroporation14 (Extended Data Fig. 2r). ZMYND8 deficiency in naive P14 cells also increased effector-like cells and reduced Texterm and Texprog cells (Extended Data Fig. 2s–u), indicating that ZMYND8 shapes Tex heterogeneity in both naive and preactivated CD8+ T cells.

Next, we assessed the effects of ZMYND8 deficiency on CD8+ T cells in multiple lymphoid and non-lymphoid tissues during chronic infection. Upon ZMYND8 deficiency, effector-like cells were increased in all tissues examined, accompanied by reduced Texterm cell accumulation (Extended Data Fig. 3a–c). Thus, ZMYND8 deficiency affects Tex heterogeneity across multiple tissues. Nonetheless, ZMYND8 deficiency showed limited effect on blood accessibility11 of CD8+ T cells (Extended Data Fig. 3d,e), suggesting that ZMYND8 deletion-induced effects on the Tex states are largely independent of alterations in lymphoid tissue residency.

Pseudotime analysis revealed that sgZmynd8-expressing cells predominantly accumulated in the TexKLR clusters (Extended Data Fig. 3f). ZMYND8 deficiency resulted in a substantial increase in cells co-expressing the TexKLR markers CD94 and NKG2D among total P14 cells or Tex subpopulations (Fig. 2d and Extended Data Fig. 3g,h). Similarly, ZMYND8 deficiency increased TexKLR cells at 90 dpi and in multiple lymphoid and non-lymphoid tissues (Extended Data Fig. 3i,j). We had similar observations using Cas9-RNP editing of naive P14 cells (Extended Data Fig. 3k,l). Furthermore, ZMYND8-deficient P14 cells showed an increase in the proportion of cells expressing NK1.1, or those co-expressing NKG2A and CD94 or CX3CR1 and KLRG1 (Extended Data Fig. 3m–o), all of which mark TexKLR cells12,13. Such accumulation effects were observed mainly in effector-like cells (Extended Data Fig. 3p,q). Therefore, ZMYND8 opposes TexKLR cell accumulation.

We next tested whether ZMYND8 directly regulates the transition from Texprog or effector-like cells to more differentiated states (Extended Data Fig. 4a). Following secondary transfer of either subpopulation, ZMYND8 deficiency led to accumulation of effector-like cells and reduction of Texterm cells (Fig. 2e,f and Extended Data Fig. 4b,c). Then, we tested the effects of ZMYND8 deficiency on the differentiation of Texint into TexKLR and Texterm cells (Extended Data Fig. 4d). ZMYND8 deficiency enhanced TexKLR cell accumulation and impaired Texterm cell formation (Extended Data Fig. 4e,f). Therefore, targeting ZMYND8 increases accumulation of effector-like cells by enhancing the differentiation of Texprog cells into effector-like states and restricting their transition into Texterm cells; moreover, these effects are associated with enhanced differentiation of Texint cells into TexKLR over Texterm cells.

ZMYND8 loss enhances antiviral immunity

These findings raised the possibility that targeting ZMYND8 enhances CD8+ T cell effector function and antiviral capacity. Indeed, Gzma and Gzmb were upregulated in ZMYND8-deficient effector-like and Texterm states (Extended Data Fig. 4g,h). Accordingly, ZMYND8-deficient P14 cells contained increased GZMA+ and GZMB+ frequencies in multiple tissues (Extended Data Fig. 4i–k). To directly assess the cytotoxic capacity of ZMYND8-deficient P14 cells, we used an established ex vivo killing assay11 (Extended Data Fig. 4l) and found that ZMYND8-deficient Tex subpopulations all showed increased target cell killing capacity (Fig. 2g and Extended Data Fig. 4m).

In an in vivo killing assay22, mice receiving ZMYND8-deficient P14 cells showed more efficient clearance of splenocytes pulsed with LCMV epitope glycoprotein33–41 (gp33) peptide (Fig. 2h), suggesting improved target cell killing in vivo upon ZMYND8 deficiency. Additionally, there was an increased ratio of adoptively transferred ZMYND8-deficient P14 cells compared with endogenous gp33-specific CD8+ T cells in these mice (Extended Data Fig. 4n). Furthermore, ZMYND8-deficient P14 cells exhibited increased effector-like and reduced Texterm cell frequencies compared to either endogenous gp33-specific CD8+ T cells or sgNTC-expressing P14 cells (Extended Data Fig. 4o). Concurrently, TexKLR cells were increased (Extended Data Fig. 4p,q), supporting a critical role for ZMYND8 in dictating TexKLR versus Texterm fate choices. Finally, in viral load measurements10, mice receiving ZMYND8-deficient P14 cells showed a modest reduction of viral burdens (Extended Data Fig. 4r). Thus, ZMYND8 deletion improves antiviral immunity during LCMV Cl13 infection.

IL-2-based therapies reinvigorate Tex antiviral responses23,24. Accordingly, the STAT5CA Up signature was enriched in effector-like cells (Fig. 2i and Extended Data Fig. 5a), with ZMYND8-deficient Texprog and effector-like cells showing elevated STAT5CA Up and decreased STAT5CA Down activities (Extended Data Fig. 5b). Moreover, ZMYND8 deficiency increased STAT5 activity (Extended Data Fig. 5c,d), and this was associated with altered STAT5CA-mediated signatures (Extended Data Fig. 5e–g and Supplementary Table 8). Furthermore, in CD8+ T cells from a public dataset24, ZMYND8 activity was negatively associated with IL-2 responses (Extended Data Fig. 5h). We therefore tested whether ZMYND8 deficiency enhances IL-2 therapeutic effects on antiviral control (Extended Data Fig. 5i). Mice receiving the ZMYND8-deficient P14 cells plus IL-2 combination exhibited lower viral loads compared to those receiving either monotherapy (Extended Data Fig. 5j). Mice receiving this combination therapy also showed further clearance of gp33 peptide-pulsed splenocytes (Fig. 2j), indicative of improved in vivo killing. These results reveal a cooperative effect on antiviral immunity by combining Zmynd8 targeting and IL-2 treatment.

We next explored the underlying cellular mechanisms. IL-2 treatment markedly reduced the accumulation of Texterm cells, whereas effector-like cells were increased (Fig. 2k,l and Extended Data Fig. 5k), largely mirroring effects of ZMYND8 loss. The combination of ZMYND8 deletion and IL-2 treatment resulted in a more pronounced increase in effector-like cells, including TexKLR cells (Fig. 2l,m). Together, ZMYND8 restricts IL-2 responses, and combinatorial targeting of ZMYND8 in CD8+ T cells together with IL-2 treatment boosts antiviral immunity.

ZMYND8 antagonizes IL-2 signalling

We next explored the mechanistic basis of how ZMYND8 restrains IL-2 responses. Based on assay for transposase-accessible chromatin using sequencing (ATAC–seq) analysis (Extended Data Fig. 5l), chromatin accessibility was increased at multiple effector-associated gene loci in ZMYND8-deficient effector-like cells (Extended Data Fig. 5m–o). Transcription factor activity inference revealed increased STAT5A and STAT5B activities in ZMYND8-deficient Texprog and effector-like cells (Fig. 3a, Extended Data Fig. 5p and Supplementary Table 9). Furthermore, genes with enhanced chromatin accessibility in both ZMYND8-deficient subpopulations were enriched for IL-2–STAT5 signalling signatures (Extended Data Fig. 5q), suggesting that ZMYND8 deficiency alters the epigenetic landscape of IL-2 target genes.

Fig. 3: ZMYND8 antagonizes IL-2R–STAT5 signalling in CD8+ T cells.

a, In ATAC–seq, top 10 transcriptional regulators enriched in ZMYND8-deficient Tex subpopulations ranked by GIGGLE score in Cistrome analysis. b, p-STAT5+ cell frequencies among indicated populations at 7 dpi (dual-colour transfer system; Methods) (n = 6 per group). c, Relative geometric mean fluorescence intensities (gMFIs) (normalized to co-transferred spike cells) of TOX in indicated P14 cell populations (from dual-colour transfer system) at 21 dpi (n = 8 per group). d, CD25+ cells among indicated P14 cell populations (n = 6 per group). e, gMFIs of CD122 on indicated P14 cell populations at 7 dpi (n = 5 per group). f, Immunoblot analysis of p-STAT5 and total STAT5 levels in human CD8+ T cells. Densitometric quantification of p-STAT5 is shown. For gel source data, see Supplementary Fig. 2. g–i, Human CD8+ T cells were subjected to acute or chronic stimulation. g, Frequency of CD25+ cells and gMFI of CD122 on day 30 after chronic stimulation (n = 4 technical replicates per group). Frequencies of PD-1+ and TOX+ cells (h) or IFNγ+TNF+ and GZMB+ cells (i) on day 30 after indicated stimulation (n = 3 technical replicates per group in h,i). Numbers in i indicate fold changes. j–l, Relative frequency and number of effector-like cells (j), TexKLR cells (k) or TOX+ cells (l) among P14 cells at 21 dpi (n = 6 per group). The sgNTC and sgZmynd8 groups in k include data from one experimental cohort shared with Extended Data Fig. 8l. Data are representative of three (b–h,j–l) or two (i) independent experiments. Two-tailed unpaired Student’s t-test (b–e,g–i) or one-way ANOVA (j–l). Data are presented as mean ± s.e.m. (b–e,g–l).

Source data

To further test this, we performed a single-cell multiome analysis. ZMYND8-deficient cells exhibited increased effector-like cells and reduced Texprog and Texterm cells (Extended Data Fig. 6a–c), and increased chromatin accessibility at Gzma, Gzmb and Klre1 but reduced accessibility at Cd101 (Extended Data Fig. 6d). STAT5 motifs were enriched in ZMYND8-deficient total P14 cells and their subpopulations (Extended Data Fig. 6e). Next, we directly assessed STAT5 phosphorylation following IL-2 stimulation, and observed increased phosphorylated STAT5 (p-STAT5) levels in ZMYND8-deficient cells (Fig. 3b). ZMYND8-deficient Tex subpopulations also showed reduced TOX levels across multiple time points and tissues (Fig. 3c and Extended Data Fig. 6f,g). The expression of the STAT5 targets Il2ra and Il2rb mediates sensitivity to IL-22. Il2ra expression was highest in TexKLR cells, while Il2rb expression was largely comparable in Texint, TexKLR and Texterm cells (Extended Data Fig. 6h). Similar patterns were observed for CD25 and CD122 surface expression (Extended Data Fig. 6i,j), suggesting that effector-like populations are marked by selective CD25 upregulation. Furthermore, ZMYND8 deletion enhanced CD25 and CD122 expression, including in effector-like cells (Fig. 3d,e and Extended Data Fig. 6k–o). Together, these data show that ZMYND8 functions as an epigenetic brake on IL-2R–STAT5 signalling in Tex states.

To establish conserved effects, we generated ZMYND8-deficient human CD8+ T cells and assessed IL-2–STAT5 signalling. p-STAT5 levels were increased upon ZMYND8 deficiency (Fig. 3f). Next, we utilized an established in vitro model25 to test the effects of ZMYND8 deletion on human T cell states (Extended Data Fig. 7a). As expected25, compared to acutely stimulated cells, cells receiving chronic T cell receptor (TCR) stimulation showed hallmark features of exhaustion (Extended Data Fig. 7b,c). Of note, ZMYND8-deficient human CD8+ T cells displayed higher expression of CD25 and CD122 under these conditions (Fig. 3g and Extended Data Fig. 7d). Furthermore, ZMYND8 deficiency decreased the expression of PD-1 and TOX but augmented IFNγ, TNF and GZMB production, with stronger effects observed under the chronic stimulation condition (Fig. 3h,i and Extended Data Fig. 7e–h). These results were validated using independent sgRNAs targeting ZMYND8 (Extended Data Fig. 7i–n). Moreover, during chronic stimulation, ZMYND8 deficiency increased and decreased the frequencies of Ki-67+ cells and active caspase-3+ cells, respectively (Extended Data Fig. 7o,p). Furthermore, loss of ZMYND8 improved the long-term persistence of human CD8+ T cells during chronic stimulation (Extended Data Fig. 7q). These results reveal conserved effects for ZMYND8 in mouse and human CD8+ T cells.

We next tested whether the effects of ZMYND8 deficiency on Tex cells are mediated by IL-2–STAT5 signalling. We first generated P14 cells lacking ZMYND8 and STAT5B alone or in combination, followed by adoptive transfer into mice and LCMV Cl13 infection (Extended Data Fig. 8a,b). Co-deletion of STAT5B reversed the increases in effector-like and TexKLR cell accumulation in ZMYND8-deficient cells (Fig. 3j,k), as well as the enhanced expression of GZMA, GZMB and IFNγ (Extended Data Fig. 8c). STAT5B co-deficiency also largely reversed the phenotypes of reduced TOX expression (Fig. 3l) and Texprog or Texterm accumulation (Extended Data Fig. 8d,e). Similar effects were largely observed upon co-deletion of CD25 or CD122 in ZMYND8-deficient cells (Extended Data Fig. 8f–o). Collectively, these results show that ZMYND8 restrains IL-2R expression and STAT5 signalling, thereby contributing to increased TOX expression and CD8+ T cell exhaustion.

ZMYND8 limits p300 activation of IL-2R

We mapped chromatin occupancy of ZMYND8 by performing cleavage under targets and release using nuclease (CUT&RUN) assay. Among core ZMYND8 binding sites (2,863 peaks in total), IL-2–STAT5 signalling was the most enriched pathway (Fig. 4a), which included Il2ra and Il2rb (Supplementary Table 10). Accordingly, ZMYND8 mainly bound to the gene body of Il2ra and more upstream region of Il2rb (Extended Data Fig. 9a), suggesting that ZMYND8 may directly modulate IL-2R expression in CD8+ T cells during chronic infection.

Fig. 4: ZMYND8 diminishes IL-2R expression by repressing p300-mediated transcriptional activation.

a–e, At 7 dpi, P14 cells were profiled by CUT&RUN assay using the indicated antibodies (n ≥ 2 per group; Methods). a, Functional enrichment analysis of ZMYND8 binding sites. BCR, B cell receptor; GO, Gene Ontology; PID, Pathway Interaction Database. b, Venn diagram showing overlapped ZMYND8 binding peaks compared with those of H3K4me1 and H3K27Ac. c, Control IgG, anti-ZMYND8, anti-H3K4me1 and anti-H3K27Ac CUT&RUN signals at Il2ra and Il2rb. d, Control IgG, anti-ZMYND8 and anti-p300 CUT&RUN signals in sgNTC-expressing P14 cells at Il2ra. e, Representative anti-p300, anti-ZMYND8 and anti-H3K27Ac CUT&RUN signals at Il2ra in sgNTC or sgZmynd8-expressing P14 cells. The same average signals of control IgG and anti-ZMYND8 (average signals from 2 (IgG) or 3 (anti-ZMYND8) biological replicates in Extended Data Fig. 9a) are presented in c,d and Extended Data Fig. 9d. Anti-p300 #1 (d) and anti-p300 sgNTC (e) are derived from the same sample. In d,e, red boxes indicate regions of anti-ZMYND8 signals that overlap with anti-p300 and/or anti-H3K27Ac. f, Normalized luciferase activity in Jurkat cells nucleofected with luciferase reporter constructs containing the IL2RA enhancer CaRE4 sequence (or scramble sequence) upstream of a generic minimal promoter and stimulated for 24 h (n = 4 per group). g–i, Relative frequency and number of effector-like cells (g) or TexKLR cells (h) among P14 cells at 21 dpi. i, Relative frequency of CD25+ P14 cells and relative gMFI of CD122 on P14 cells (n = 7 per group). Data are pooled from two independent experiments (g–i) or are representative of two independent experiments (a–f). Two-tailed Fisher’s exact test (a), two-way ANOVA (f) or one-way ANOVA (g–i). Data are presented as mean ± s.e.m. (f–i).

Source data

ZMYND8 is an epigenetic reader that recognizes various histone modifications26, so we performed CUT&RUN for these known histone marks26 and assessed their overlaps with ZMYND8-bound genomic locations. The majority of core ZMYND8 binding sites were in promoter, intronic and distal regions (Extended Data Fig. 9b), resembling binding patterns of H3K4me1 and H3K27Ac marks (Fig. 4b and Extended Data Fig. 9c). ZMYND8 binding on Il2ra and Il2rb extensively overlapped with H3K4me1 and H3K27Ac-bound regions (Fig. 4c), whereas there was limited overlap between ZMYND8 binding sites with those of H3K14Ac, H3K36me2, H4K16Ac and H3K4me3, especially on Il2ra relative to Il2rb (Extended Data Fig. 9d). Since gene loci marked by both H3K4me1 and H3K27Ac often define active enhancer elements27, these findings suggest that ZMYND8 preferentially binds to active enhancer elements. Next, we performed CUT&RUN for H3K27Ac using wild-type Tex subpopulations and superimposed the results with ZMYND8-bound regions on Il2ra. H3K27Ac deposition at ZMYND8-bound regions on Il2ra was highest in effector-like and lowest in Texterm cells (Extended Data Fig. 9e,f), in line with increased Il2ra expression in effector-like cells (Extended Data Fig. 9g). Therefore, H3K27Ac deposition at ZMYND8-bound active enhancer regions of Il2ra is associated with Il2ra expression.

H3K27Ac levels are regulated by the histone acetyltransferase p30027. The occupancies of H3K27Ac and p300 were enriched in ZMYND8-bound regions in CD8+ T cells (Extended Data Fig. 9h,i). CUT&RUN assays revealed that p300 and ZMYND8 co-occupied enhancer regions on Il2ra and Il2rb, and p300 occupancy and H3K27Ac levels were increased at these loci in ZMYND8-deficient cells (Fig. 4d,e and Extended Data Fig. 9j–l). Furthermore, co-immunoprecipitation assays revealed the interaction of ZMYND8 and p300 in CD8+ T cells (Extended Data Fig. 9m). Finally, in ATAC–seq profiling, chromatin regions with increased accessibility in ZMYND8-deficient cells were enriched for p300 occupancy sites (Fig. 3a). Together, ZMYND8 deficiency enhances p300 chromatin occupancy, H3K27Ac deposition and p300-associated chromatin accessibility at selective loci in CD8+ T cells.

To test whether ZMYND8 functions as a transcriptional repressor for Il2ra transcription by restricting p300-mediated enhancer activity, we performed a luciferase reporter assay in Jurkat cells nucleofected with reporter constructs containing the IL2RA enhancer (CaRE4)28. Upon TCR stimulation, co-expression of ZMYND8 markedly suppressed p300-mediated transactivation of IL2RA (Fig. 4f), supporting a direct inhibitory effect of ZMYND8 on p300-driven enhancer activity on the IL2RA locus. To dissect the functional domains required for ZMYND8 to repress p300-driven transcriptional activity, we constructed ZMYND8 truncation mutants lacking the individual PHD (ΔPHD), BRD (ΔBRD), PWWP (ΔPWWP), triple-reader cassette (ΔPHD–BRD–PWWP) or MYND (ΔMYND) domain (Extended Data Fig. 9n). Notably, the ΔPHD, ΔBRD, ΔPWWP (to a lesser extent) and ΔPHD–BRD–PWWP mutants did not suppress p300-driven IL2RA transcription (Extended Data Fig. 9o). These findings suggest that the histone-reader domains29 of ZMYND8 contribute to repressing p300-dependent transcriptional regulation. Moreover, co-immunoprecipitation assays in HEK293T cells revealed reduced interactions between p300 and ZMYND8 truncation mutants lacking the PHD, PWWP (to a lesser extent) or PHD–BRD–PWWP domain (Extended Data Fig. 9p). Collectively, the histone-reader domains of ZMYND8 contribute to both its interaction with and repression of p300.

Targeting Ep300 reduced effector-like cell frequency but increased the proportions of Texprog and Texterm cells (Extended Data Fig. 10a–c and Supplementary Table 11), which were validated by flow cytometry analysis (Extended Data Fig. 10d–g). Therefore, p300 deficiency produces phenotypic effects that oppose those of ZMYND8 deficiency. To directly test whether the effect of ZMYND8 deletion is dependent upon p300, we co-targeted ZMYND8 and p300 in Cas9+ P14 cells (Extended Data Fig. 10h), followed by adoptive transfer and LCMV Cl13 infection. Co-deletion of p300 blocked the increased effector-like states induced by ZMYND8 loss (Fig. 4g,h), and rectified the reductions in Texprog or Texterm cell accumulation (Extended Data Fig. 10i,j). Co-deletion of p300 also reversed the increased CD25 and CD122 expression on ZMYND8-deficient P14 cells (Fig. 4i). Together, these findings define a ZMYND8–p300 axis that reciprocally regulates IL-2R expression and effector-like cell differentiation.

Chronic stimulation upregulates ZMYND8

Zmynd8 expression was higher in CD8+ T cells at late stage of chronic infection versus early stage or acute infection (Fig. 5a). During chronic infection, Zmynd8 or Tox expression progressively increased and was highest in Texterm and lowest in effector-like cells, especially in TexKLR cells (Fig. 5b,c and Extended Data Fig. 11a). Furthermore, Zmynd8 expression or ZMYND8-activated signature was enriched in the Texterm state, whereas ZMYND8-suppressed signature was most prevalent in the TexKLR state (Extended Data Fig. 11b–e). In human CD8+ T cells from HIV-infected patients30, ZMYND8 expression was positively correlated with exhaustion-related genes (Extended Data Fig. 11f), and the ZMYND8-activated signature activity was highest in individuals with high viral titres (Extended Data Fig. 11f), suggesting the association of ZMYND8 with human CD8+ T cell exhaustion.

Fig. 5: ZMYND8 deficiency enhances the efficacies of IL-2 therapy and ICB.

a, Zmynd8 expression in CD8+ T cells. b, Zmynd8 (n = 6 per group) and Tox (n = 7 per group) expression in P14 cells. c, Zmynd8 and Tox expression in Tex subpopulations (n = 8 per group). d, Immunoblot analysis of ZMYND8 in human CD8+ T cells after indicated stimulation, with densitometric quantification of ZMYND8 shown. For gel source data, see Supplementary Fig. 2. e, ZMYND8 expression in human CD8+ T cells during chronic stimulation (n = 5 technical replicates per group). f, Relative frequencies of CD25+, NKG2D+, p-STAT5+ and TOX+ intratumoural P14 cells and CD122 gMFI on intratumoural P14 cells (n = 6 per group). g, B16-gp33 tumour growth in mice treated with indicated P14 cells. h, B16-gp33 tumour growth in mice that received indicated treatments. i, B16F10 tumour growth in mice that received indicated treatments. j, ZMYND8-associated signature activities and ZMYND8 expression in CD8+ T cell subpopulations (n = 11,906 memory, n = 4,156 activated and n = 1,246 exhausted cells). k, Frequencies of CD25+ intratumoural P14 cells (n = 6 per group). l, Relative frequency of p-STAT5+ intratumoural P14 cells (n = 7 per group). m, B16-gp33 tumour growth in mice that received indicated treatments. n, Intratumoural P14 cell number (n = 6 per group). o, Frequency of TOX+ P14 cells (n = 5 per group). p, In vivo killing assay in mice that received indicated treatments (n = 5 per group). Data are representative of three (f,g,k) or two (b–e,h,i,l–p) independent experiments. Two-tailed unpaired Student’s t-test (f), two-tailed Wilcoxon rank-sum test (j), one-way ANOVA (b,c,e) or two-way ANOVA (g–i,k–p). Data are presented as mean ± s.e.m. (b,c,e,f,k,l,n–p).

Source data

Beyond chronic infection, the ZMYND8-activated signature and Zmynd8 expression were also increased in Texterm compared with Texprog or effector-like cells in mouse tumour models31,32, and the ZMYND8-suppressed signature was increased in effector-like cells (Extended Data Fig. 11g–i). In a mouse liver cancer model33, ZMYND8-activated and suppressed signatures were respectively upregulated and downregulated as T cells became progressively dysfunctional (Extended Data Fig. 11j). Similarly, in intratumoural CD8+ T cells from patients with melanoma34, ZMYND8-activated signature and Zmynd8 expression were highest in the dysfunctional state (Extended Data Fig. 11k). Together, ZMYND8 expression and/or activity are conserved features of terminal exhaustion across chronic viral infections and tumours.

Prolonged TCR stimulation in vitro recapitulates exhaustion-like features in T cells35. Following sustained TCR stimulation in vitro, ZMYND8 expression gradually increased (Extended Data Fig. 11l). Furthermore, ZMYND8 expression was higher in human CD8+ T cells under the chronic versus acute stimulation condition25 (Fig. 5d), with progressively increased ZMYND8 expression observed over time (Fig. 5e). Therefore, chronic TCR stimulation promotes ZMYND8 expression in both mouse and human CD8+ T cells.

ZMYND8 loss improves IL-2 immunotherapy

Defects in IL-2 signalling in CD8+ T cells are a major barrier for cancer immunotherapy2, so we tested whether ZMYND8 deletion unleashes IL-2 signalling in tumours. ZMYND8-deficient P14 cells exhibited increased levels of CD25, CD122 and p-STAT5, along with increased NKG2D and reduced TOX expression, in B16F10 tumours expressing gp33 (B16-gp33) (Fig. 5f). In a human CD19 chimeric antigen receptor (CAR) T cell model19,31,36, ZMYND8-deficient CAR T cells also showed increased CD25, CD122 and p-STAT5 levels and reduced TOX expression (Extended Data Fig. 11m,n). NKG2D expression was also upregulated on ZMYND8-deficient CAR T cell populations (Extended Data Fig. 11o). Therefore, ZMYND8 deficiency enhances IL-2R–STAT5 signalling and promotes NK-like features in tumour-reactive CD8+ T cells, including CAR T cells.

Next, we assessed the antitumour effects of targeting ZMYND8. In B16-gp33 tumour-bearing mice, adoptive transfer of ZMYND8-deficient P14 cells reduced tumour burden and prolonged the survival of tumour-bearing mice (Fig. 5g and Extended Data Fig. 12a–d). In public datasets from melanoma or sarcoma-bearing mice treated with or without IL-237,38, ZMYND8 activity in CD8+ T cells was inversely associated with IL-2 responses (Extended Data Fig. 12e,f). Moreover, combining IL-2 treatment with adoptive cell therapy of ZMYND8-deficient P14 cells further enhanced tumour control and prolonged the survival of B16-gp33 tumour-bearing mice relative to either monotherapy (Fig. 5h and Extended Data Fig. 12g–i). ZMYND8-deficient pmel cells (which recognize an endogenous B16F10 melanoma antigen) also exhibited improved control of B16F10 tumour growth, with IL-2 combination therapy further enhancing tumour control and extending the survival of tumour-bearing mice (Fig. 5i and Extended Data Fig. 12j). Collectively, ZMYND8 deficiency in tumour-reactive CD8+ T cells acts cooperatively with IL-2 therapy, resulting in potent antitumour effects.

ZMYND8 deletion enhances ICB therapy

Next, we tested whether ZMYND8 deletion regulates ICB responses. In public datasets from patients with advanced basal cell carcinoma and squamous cell carcinoma39, an activated CD8+ T cell population induced by anti-PD-1 treatment showed reduced ZMYND8-activated signature activity, as well as lower ZMYND8 expression, compared with the exhausted population (Fig. 5j and Extended Data Fig. 12k,l). The reciprocal pattern was observed for the ZMYND8-suppressed signature (Fig. 5j and Extended Data Fig. 12l). Moreover, ICB responders in colorectal cancer40 and melanoma41 showed negative correlation with ZMYND8 activity or expression in intratumoural CD8+ T cells (Extended Data Fig. 12m–o). Therefore, ZMYND8 activity and expression are negatively associated with ICB responses in human CD8+ T cells from patients with cancer.

Increased IL-2 engagement in CD8+ T cells enhances the efficacy of ICB23,24. In B16-gp33 tumours treated with anti-PD-L1, ZMYND8 deficiency still increased the frequencies of CD25+ cells among intratumoural Tex populations (Fig. 5k and Extended Data Fig. 12p,q). ZMYND8-deficient P14 cells also exhibited increased p-STAT5 (Fig. 5l) and decreased TOX levels (Extended Data Fig. 12r) under both isotype and anti-PD-L1 treatment conditions. Moreover, whereas TOX expression was increased in intratumoural control P14 cells after cessation of anti-PD-L1 treatment, such upregulation was dampened by ZMYND8 deficiency (Extended Data Fig. 12s), suggesting that ZMYND8 deficiency partly overcomes maladaptive reprogramming of Tex cells following ICB42. Accordingly, the combination of ZMYND8-deficient P14 cells with PD-L1 blockade improved tumour control, mouse survival and intratumoural P14 cell accumulation compared with either treatment alone (Fig. 5m,n and Extended Data Fig. 12t,u).

Similarly, during LCMV Cl13 infection, TOX expression was substantially suppressed upon ZMYND8 deletion under both isotype and anti-PD-L1 treatment conditions (Fig. 5o). Furthermore, mice receiving adoptive transfer of ZMYND8-deficient P14 cells plus anti-PD-L1 showed greater in vivo killing capacity (Fig. 5p), associated with reduced viral loads (Extended Data Fig. 12v). Collectively, ZMYND8 is a key driver of TOX expression and CD8+ T cell exhaustion in chronic infection and tumours and represents a therapeutic target to enhance protective immunity and boost the efficacies of IL-2 and ICB therapies (Extended Data Fig. 12w).

Discussion

T cell exhaustion remains a major barrier for effective immunity against chronic infection and cancer1,3, yet mechanisms governing the divergence of effector-like and Texterm cell fate choices are not well understood. Here we identified that the chromatin reader ZMYND8 impeded the formation of effector-like states but promoted Texterm cell generation, thereby limiting responses to immunotherapies. ZMYND8 deficiency improved cytolytic function of Tex populations, including the Texterm subpopulation whose functional reinvigoration remains challenging1,3. Loss of ZMYND8 also enhanced IL-2 signalling but lowered TOX expression, suggesting the beneficial effects of targeting ZMYND8 to drive expansion of effector-like (especially TexKLR) cells and counteract maladaptive Tex reprogramming. Elevated ZMYND8 expression and activity in Tex cells were a shared feature across chronic infection and cancer. These results suggest that chronic TCR stimulation elicits ZMYND8-mediated feedback inhibition of IL-2 signalling, thereby highlighting an epigenetic rheostat imposing signal 1 (chronic antigen stimulation)-induced suppression of signal 3 cytokine signalling to enforce T cell exhaustion.

During chronic stimulation, Tex cells receive suboptimal IL-2 signals and acquire a hypofunctional state2, so strategies that engage high-affinity IL-2R signalling are likely to induce robust therapeutic effects. We found that ZMYND8 directly bound to Il2ra gene enhancers to suppress their transcriptional activation, revealing an epigenetic surveillance mechanism that accounts for the progressive loss of IL-2Rα expression and impaired IL-2R–STAT5 signalling in T cell exhaustion2. Moreover, increased IL-2R signalling altered Tex heterogeneous states and especially enhanced effector-like cell generation in the context of ZMYND8 deficiency. Given the dose-limiting toxicities of systemic IL-2 therapy2, these findings have implications for emerging IL-2 and IL-2R engineering strategies to enhance IL-2 signalling selectively in therapeutic CD8+ T cells2. Moreover, the observed negative association between ZMYND8 and ICB response suggests that targeting ZMYND8 may complement ICB-based immunotherapies by enhancing IL-2–IL-2Rα engagement24. Nonetheless, the broader applicability of our findings beyond chronic LCMV infection and melanoma warrants further investigation.

Despite limited studies in immune cells, ZMYND8 is a chromatin reader that recognizes multiple histone modifications in tumour cells29,43. We revealed that ZMYND8 and the histone acetyltransferase p300 selectively co-occupied active enhancers in IL-2 signalling genes, and ZMYND8 suppressed p300 activity and H3K27Ac modification at these gene loci (Extended Data Fig. 12w). Targeting ZMYND8 relieved this epigenetic ‘brake’ and increased IL-2Rα expression and downstream STAT5 activation, with p300 co-deletion reversing these effects. Therefore, ZMYND8 is a potent repressor of p300 activity that is required for IL-2R–STAT5 signalling, highlighting an epigenetic–cytokine signalling axis underlying CD8+ T cell hypofunctional adaptation. As p300 recruitment and chromatin engagement are facilitated by STAT5 in helper CD4+ T cells44, ZMYND8-dependent suppression of p300-mediated H3K27Ac deposition may also require STAT5 in CD8+ T cells. Collectively, we have identified an epigenetic rheostat ZMYND8 mediating the reciprocal generation of TexKLR versus Texterm cells and the marked downregulation of the high-affinity IL-2R subunit during T cell exhaustion. These findings uncover that epigenetic rewiring connects immune signals 1 and 3 to shape Tex heterogeneity and function.

Methods

Mice

C57BL/6, P14 TCR-transgenic (Tg)45, pmel TCR-Tg46 and Rosa26-Cas9 knock-in47 mice were purchased from the Jackson Laboratory. Human CD19 CAR-Tg mice were provided by T. Geiger36. We crossed Rosa26-Cas9 knock-in mice with P14, pmel or human CD19 (hCD19) CAR-Tg mice to express Cas9 in antigen-specific CD8+ T cells. The Cas9-expressing mice were fully backcrossed to the C57BL/6 background. Sex-matched (male or female) mice were used at 7–12 weeks of age unless otherwise noted and assigned randomly to control and experimental groups. All mice were maintained in a specific pathogen-free facility in the Animal Resource Center at St. Jude Children’s Research Hospital. Mice were kept with 12 h–12 h light–dark cycles that coincide with daylight in Memphis, TN, USA. The St. Jude Children’s Research Hospital Animal Resource Center housing facility was maintained at 30–70 % humidity and 20–25 °C. Animal protocols were approved by and performed in accordance with the Institutional Animal Care and Use Committee (IACUC) of St. Jude Children’s Research Hospital.

Cell lines

The Plat-E cell line was provided by Y.-C. Liu and cultured in Dulbecco’s modified essential medium (DMEM) (Gibco) supplemented with 10% (v/v) FBS and 1% (v/v) penicillin–streptomycin. B16-gp33 cell line was provided by B. Youngblood and the B16-hCD19 cell line was generated as described31. B16F10, BHK (CL-10), Vero (CCL-81), Jurkat (E6-1) and HEK293T cell lines were purchased from the American Type Culture Collection (ATCC). All tumour cell lines were cultured in RPMI 1640 medium (Gibco) supplemented with 10% (v/v) FBS and 1% (v/v) penicillin–streptomycin. No commonly misidentified cell lines were used in this study (International Cell Line Authentication Committee). Cell lines used in this study were not independently authenticated or tested for Mycoplasma contamination.

Naive T cell isolation and viral transduction

Naive Cas9-expressing P14, pmel or hCD19 CAR-Tg cells were isolated from the spleen and peripheral lymph nodes of P14-Cas9, pmel-Cas9 and CAR-Tg-Cas9 mice using a naive CD8α+ T cell isolation kit (Miltenyi Biotec) according to the manufacturer’s instructions. Purified naive P14, pmel and hCD19 CAR-Tg T cells were activated in vitro for 20 h with 10 μg ml–1 anti-CD3 (145-2C11; Bio-X-Cell) and 5 μg ml–1 anti-CD28 (37.51; Bio-X-Cell) antibodies before viral transduction. Viral transduction was performed by spin-infection at 900g at 25 °C for 3 h with 10 μg ml–1 polybrene (Sigma-Aldrich), followed by 2 h rest at 37 °C and 5% CO2. After transduction, cells were cultured in T cell medium (Click’s medium (IrvineScientific) supplemented with 10% FBS, 55 μM 2-mercaptoethanol and 1× penicillin–streptomycin–l-glutamine (Gibco)) with recombinant human IL-2 (20 IU ml–1; National Cancer Institute or PeproTech), mouse IL-7 (12.5 ng ml–1; PeproTech) and IL-15 (25 ng ml–1; PeproTech) for 3 days. Transduced cells were sorted based on the expression of Ametrine or GFP (as indicated in the figure legends) using a Reflection cell sorter (iCyt) before adoptive transfer into recipient mice. sgRNAs were designed using an online tool (https://portals.broadinstitute.org/gppx/crispick/public), and the sgRNAs used in this study are listed in Supplementary Table 11. Unless otherwise indicated in the text, the guides used for targeting Zmynd8, ZMYND8 and Ep300 in all experiments were sgZmynd8.g2, sgZMYND8.g1 and sgEp300.g2, respectively. The retroviral sgRNA vector was previously described19,22. Retrovirus was produced by co-transfecting Plat-E cells with the core plasmid (sgRNA plasmid) and the packaging plasmid pCL-Eco (Addgene, #12371) and was collected 48 h after transfection. Co-deletion experiments were performed through double transduction of Cas9-expressing CD8+ T cells with Ametrine- and GFP-expressing retroviral vectors (Ametrine and GFP co-expression marked cells that had undergone successful dual transduction), followed by flow cytometry analysis.

Adoptive T cell transfer

For chronic LCMV infection, a total of 1 × 104 retrovirus-transduced Cas9+ P14 CD8+ T cells were adoptively transferred intravenously into sex-matched Cas9-expressing recipient mice before infection to minimize the potential rejection. For tumour models, retrovirus-transduced Cas9+ P14, pmel or hCD19 CAR-Tg cells were adoptively transferred intravenously to the tumour-bearing mice on either day –1 (1 × 106 cells per mouse) or day 7 (4 × 106 per mouse) after tumour inoculation (as indicated in the figure legends). In the single-colour transfer system to assess antitumour effects, antigen-specific T cells transduced with sgNTC or the indicated sgRNAs (expressing the same fluorescent reporter protein) were transferred to separate hosts. In the dual-colour transfer system (for assessment of phenotypic alterations), cells transduced with the indicated sgRNAs marked by the expression of Ametrine, were mixed at a 1:1 ratio with those transduced with sgNTC labelled with GFP (spike), followed by adoptive transfer to the same host. To calculate fold changes in the dual-colour transfer system, the frequency of indicated population or geometric mean fluorescence intensity (gMFI) of indicated protein was calculated relative to spike (sgNTC) cells from the same host. Specifically, the proportion or gMFI of sgRNA-transduced cells was divided by the proportion or gMFI of spike cells and further normalized to the ratio of pre-transfer input samples. For the double knockout experiments, Cas9-expressing P14 cells co-transduced with sgNTC or sgZmynd8 (both GFP+)-expressing retrovirus together with sgNTC, sgStat5b, sgIl2ra, sgIl2rb or sgEp300 (all Ametrine+)-expressing retrovirus. Then, co-transduced Cas9+ P14 cells (all GFP+Ametrine+) were mixed at a 1:1 ratio with cells transduced with sgNTC (spike cells; Ametrine+) and co-transferred into the same Cas9+ mice, followed by LCMV Cl13 infection (dual-colour transfer system). The quantification of cell number was performed by calculating the numbers of indicated sgRNA-transduced cells and the sgNTC-transduced spike cells from the same LCMV Cl13-infected or tumour-bearing host, followed by normalization to the tumour weight in the tumour model.

LCMV Cl13 infection

LCMV Cl13 virus was grown in BHK-21 cells (ATCC, CCL-10), and viral titres were determined by plaque formation assay on Vero cells (ATCC, CCL-81). To induce chronic LCMV Cl13 infection, 2 × 106 plaque-forming units (PFU) of LCMV Cl13 were injected intravenously post-adoptive transfer of P14 cells where noted. To quantify LCMV viral loads in serum and tissues of chronically infected mice, LCMV quantitative PCR (qPCR) assay was applied as previously described48. In brief, 10 mg liver and kidney samples were homogenized in the presence of lysis buffer (Buffer RLT (QIAGEN) supplemented with 1% 2-mercaptoethanol), and total RNA was isolated using the RNeasy Mini Kit (QIAGEN) according to the manufacturer’s instructions. For serum samples, RNA was extracted from 100 μl serum using RNeasy Micro Kit (QIAGEN). Then, 15 μl RNA was used in a 20 μl cDNA reverse transcription reaction with High-Capacity cDNA Reverse Transcription Kit (Thermo) and the GP-R primer shown below. cDNA from liver and kidney samples was diluted 200-fold, and cDNA from serum samples was diluted 5-fold before adding to Power SYBR Green Master Mix (Applied Biosystems) containing LCMV-specific new GP primers: GP-R (S pos. 970-991), GCAACTGCTGTGTTCCCGAAAC; and GP-F (S pos. 877-901): CATTCACCTGGACTTTGTCAGACTC.

Amplification was assessed using QuantStudio7 Flex Real-Time PCR System (Applied Biosystems). The samples from uninfected mice were used as negative control. The viral load was calculated using a known LCMV Cl13 stock (quantified by plaque formation assay) as a standard.

Secondary adoptive cell transfer assays

Cas9-expressing P14 cells transduced with sgNTC (Ametrine+) or sgZmynd8 (GFP+) were mixed at a 1:1 ratio and co-transferred into C57BL/6 mice, followed by infection with LCMV Cl13 on the same day. At 10 dpi, Texprog (Ly108+TIM-3−CX3CR1−), effector-like (Ly108−TIM-3+CD101−) or Texint (Ly108−CX3CR1+KLRG1−) populations among control (sgNTC) and ZMYND8-deficient (sgZmynd8) P14 cells in the spleen were purified by sorting. LCMV Cl13 infection-matched mice received co-transfer of a 1:1 mixture of control and ZMYND8-deficient Texprog cells (1 × 105 each), effector-like cells (2.5 × 105 each) or Texint cells (2.5 × 105 each). The differentiation of each Tex subpopulation into various Tex subpopulations (as indicated in the figures and their legends) was examined on day 9 after secondary transfer (that is, at 19 dpi) by flow cytometry analysis.

In vivo administration of biologics in LCMV Cl13-infected mice

For PD-L1 blockade, IgG isotype control antibody (200 μg per mouse; clone LTF-2, Bio-X-Cell) or anti-mouse PD-L1 antibody (200 μg per mouse; clone 10 F.9G2, Bio-X-Cell) was administered intraperitoneally into LCMV Cl13-infected mice at 13, 16, 19, 22 and 25 dpi. For IL-2 therapy, PBS or recombinant human IL-2 (rhIL-2) (1.5 × 104 IU per mouse; National Cancer Institute) was injected intraperitoneally into LCMV Cl13-infected mice once daily from 30–35 dpi for a total of 6 daily injections.

Tumour models and immunotherapeutic treatments

In the single-colour transfer system for tumour therapy assays, 5 × 105 B16-gp33 or B16F10 melanoma cells were subcutaneously injected into the right flank of C57BL/6 mice. On days 7–10 after tumour inoculation (as indicated in the figures or their legends), mice bearing tumours of a similar size were randomly divided into treatment groups (5–8 mice per group). Then, Cas9-expressing P14 (for the treatment of B16-gp33 melanoma) or pmel (for the treatment of B16F10 melanoma) CD8+ T cells transduced with sgNTC or the indicated sgRNAs (with the same fluorescent reporter protein) were adoptively transferred (4 × 106 cells per mouse) individually to tumour-bearing mice. For anti-PD-L1 treatment, the B16-gp33 tumour-bearing mice were treated with two intraperitoneal injections of anti-PD-L1 (200 μg per mouse; clone 10 F.9G2, Bio-X-Cell) or IgG isotype control antibody (200 μg per mouse; clone LTF-2, Bio-X-Cell) on days 15 and 18 after tumour inoculation. For IL-2 treatment, tumour-bearing mice were randomly divided into two groups on day 10 after tumour inoculation and intraperitoneally injected with either PBS or rhIL-2 (1 × 105 IU per mouse, dissolved in PBS) every day and 5 times in total. For the tumour model shown in Extended Data Fig. 12a–c, retrovirus-transduced Cas9+ P14 cells (1 × 106 cells per mouse) were adoptively transferred intravenously to the C57BL/6 mice one day before subcutaneous inoculation of B16-gp33 tumour cells (1 × 106 per mouse). Mice were monitored for tumour growth; tumours were measured every 2 days with digital callipers and tumour volumes were calculated using the following formula: length × width × width × π/6. For all tumour growth curves, the graphs depict the growth curves of individual tumours (dotted lines) and the average tumour volumes (bold lines). To isolate intratumoural lymphocytes, tumours were collected on the indicated days after inoculation, excised, minced and digested with 1 mg ml−1 collagenase IV (LS004188, Worthington Biochemicals) and 200 U ml−1 DNase I (DN25-1G, Sigma-Aldrich) for 1 h at 37 °C and passed through 70-μm filters to remove undigested tumour tissues. Tumour-infiltrating lymphocytes (TILs) from B16-gp33 or B16-hCD19 melanoma were further isolated by density-gradient centrifugation over Percoll (17089101, Cytiva) at 2,500 rpm for 20 min at room temperature. Tumour size limits were approved to reach a maximum of 3,000 mm3 or ≤20% of body weight (whichever was lower) by the IACUC of St. Jude Children’s Research Hospital.

Flow cytometry

For analysis of surface markers, cells were stained in PBS (Gibco) containing 2% FBS. Surface proteins were stained for 30 min at 4 °C. For transcription factor staining, cells were stained for surface molecules and then fixed with 2% paraformaldehyde (Thermo Fisher Scientific) for 30 min at room temperature, followed by permeabilization with FOXP3/transcription factor staining buffer set, according to the manufacturer’s instructions (00-5523-00, eBioscience). Intracellular staining for cytokines was performed using BD CytoFix/CytoPerm fixation/permeabilization kit (554774, BD Biosciences) after stimulation with phorbol 12-myristate 13-acetate (PMA; Sigma-Aldrich) and ionomycin (Sigma-Aldrich) in the presence of monensin (GolgiStop, 554724, BD Bioscience) for 4 h. 7-AAD (A9400, 1:200, Sigma-Aldrich) or fixable viability dye (65-0865-14; 1:2,000, eBioscience) was used for dead-cell exclusion. The following antibodies from eBioscience were used: APC–anti-CD25 (PC61.5, 17-0251-82, 1:200); APC–anti-NKG2D (1D11, 17-5878-42, 1:200); APC–anti-perforin (eBioOMAK-D, 17-9392-80, 1:200); PE–anti-TOX (TXRX10, 12-6502-82, 1:100); PE–anti-CD101 (Moushi101, 12-1011-82, 1:200); PE/Cyanine7–anti-NKG2D (CX5, 25-5882-82, 1:200); PE/Cyanine7–anti-TIM-3 (RMT3-23, 25-5870-82, 1:400); PE/Cyanine7–anti-CD101 (Moushi101, 25-1011-82, 1:200); PE/Cyanine7–anti-KLRG1 (13F12F2, 25-9488-42, 1:200); PerCP-eFluor 710–anti-CD39 (24DMS1, 46-0391-82, 1:400); PerCP-eFluor 710–anti-GZMA (GzA-3G8.5, 46-5831-82, 1:200). The following antibodies from BioLegend were used: PE–anti-CD122 (5H4, 105906, 1:200); Alexa Fluor 700–anti-CD8α (53-6.7, 100730, 1:400); Brilliant Violet 785–anti-TCRβ (H57-597, 109249, 1:400); APC–anti-Ly108 (330-AJ, 134610, 1:400); APC–anti-CD122 (5H4, 105912, 1:200); Brilliant Violet 421–anti-TNF (MP6-XT22, 506328, 1:200); Brilliant Violet 421–anti-mouse/human KLRG1 (2F1/KLRG1, 138414, 1:200); APC/Cyanine7–anti-NK1.1 (PK136, 108724, 1:200); Brilliant Violet 711–anti-CD8 (53-6.7, 100748, 1:400); Brilliant Violet 711–anti-CD366 (TIM-3) (RMT3-23, 119727, 1:400); Brilliant Violet 421–anti-CX3CR1 (SA011F11, 149023, 1:400); Brilliant Violet 650–anti-CX3CR1 (SA011F11, 149033, 1:400); PE/Cyanine7–anti-mouse Ki-67 (16A8, 652426, 1:200); Alexa Fluor 647–anti-human/mouse GZMB (GB11, 515405, 1:100); PE–anti-IFNγ (XMG1.2, 505808, 1:200). FITC–anti-human CD279 (PD-1) (A17188B, 621612, 1:200); Alexa Fluor 700–anti-human CD8 (SK1, 344724, 1:200); PerCP/Cyanine5.5–anti-human IFNγ (B27, 506528, 1:200); Brilliant Violet 711–anti-human CD366 (TIM-3) (F38-2E2, 345024, 1:400); Brilliant Violet 605–anti-human CD25 (BC96, 302632, 1:200); PE/Cyanine7–anti-human CD122 (IL-2Rβ) (TU27, 339014, 1:200); PE–anti-IFNγ (XMG1.2, 505808, 1:200). The following antibodies from BD Biosciences were used: PE–anti-STAT5 (pY694) (47, 612567, 1:20); PE–anti-NKG2A (16A11, 568952, 1:200); Brilliant Violet 605–anti-Ly108 (13G3, 745250, 1:400); Brilliant Violet 711–anti-CD94 (18d3, 740760, 1:400); Brilliant Violet 421–anti-active caspase-3 (C92-605.rMAb, 570863, 1:200); PerCP/Cyanine5.5–anti-human Ki-67 (B56, 561284, 1:200); Alexa Fluor 488–anti-human TNF (Infliximab297.rMAb, 570954, 1:100). Alexa Fluor 700–anti-TIM-3 (FAB1529RN, 1:400) was from R&D Systems, and APC–anti-human/mouse TOX (REA473, 130-118-335, 1:200) was from Miltenyi Biotec.

For p-STAT5 staining, splenocytes from LCMV Cl13-infected mice or TILs from B16-gp33 or B16-hCD19 melanoma were restimulated with 20 IU ml−1 rhIL-2 at 37 °C for 30 min in T cell medium containing antibodies for surface molecules, followed by fixation with 2% paraformaldehyde for 30 min at room temperature and permeabilization using 90% ice-cold methanol for 30 min on ice. Then, cells were stained for anti-STAT5 (pY694) (1:20) for 30 min at room temperature. Flow cytometry data were acquired using BD FACSDiva software (v8.0.1) on Fortessa or Symphony A3 cytometers (BD Biosciences) and were analysed using FlowJo software (v10.10.0; TreeStar). Representative gating strategies for all flow cytometry results are provided under Supplementary Fig. 1.

For in vivo labelling of circulatory or tissue-resident P14 cells in the spleen, PE–anti-CD8α (S18018E; 2 μg) prepared in PBS was injected intravascularly into LCMV Cl13-infected mice containing control and ZMYND8-deficient P14 cells at 21 dpi, and the recipient mice were euthanized 5 min after injection as previously described11. Splenocytes were prepared for flow cytometry analysis with surface staining using Alexa Fluor 700–anti-CD8α antibody (53-6.7, 1:400). The proportions of control and ZMYND8-deficient total P14 cells and their Tex subpopulations in the white pulp (PE–) and red pulp (PE+) were analysed by flow cytometry.

Naive CD8+ T cell RNP electroporation

For CRISPR–Cas9 editing of naive mouse CD8+ T cells, RNP complexes were prepared by mixing 2 µl of 100 µM sgRNA (Synthego) and 2 µl of 40 µM Cas9 (Alt-R S.p. Cas9 Nuclease), and incubated for 10 min at room temperature. Electroporation was performed on 1–3 × 106 naive CD8+ T cells using the 4D-Nucleofector X Unit (with program DN100) and P3 primary cell 4D-Nucleofector X Kit (V4XP-3032, Lonza). Pre-warmed complete T cell medium (100 μl) was immediately added to cells, followed by incubation at 37 °C for 10 min to allow cells to recover. Cells were washed extensively before transfer into recipient mice.

In vitro acute and chronic stimulation of human CD8+ T cells

Peripheral blood mononuclear cells were isolated from consented healthy donors by density-gradient separation using Lymphoprep (GE Healthcare). Naive CD8+ T cells (CCR7+CD45RO–) were sorted and activated with ImmunoCult Human CD3/CD28 T Cell Activator (STEMCELL Technologies) at a density of 1 × 106 cells ml–1 in X-VIVO 15 medium (Lonza) supplemented with 5% human serum (Sigma-Aldrich), 50 µM 2-mercaptoethanol and 1× penicillin–streptomycin–l-glutamine (Gibco). Two days after activation, RNP-Cas9 complexes were prepared as described above, and 1–2 × 106 activated CD8+ T cells were electroporated using the 4D-Nucleofector X Unit (using program EH-115) and P3 primary cell 4D-Nucleofector X Kit (Lonza). Pre-warmed X-VIVO 15 medium (100 μl) was immediately added to the cells, followed by incubation at 37 °C for 15 min to allow cells to recover. Cells were then transferred to a 48-well plate (Corning) and cultured for 2 additional days in complete X-VIVO 15 medium supplemented with 50 IU ml−1 rhIL-2. Afterwards, for acute stimulation, edited human CD8+ T cells were maintained under the above culture conditions, with fresh medium and cytokines replaced every 2 days. For chronic stimulation, edited human CD8+ T cells were further activated with 2 μg ml–1 plate-bound anti-human CD3 antibody (OKT3, BioLegend), and cells were replated onto fresh anti-human CD3 antibody-coated plates and replaced with fresh X-VIVO 15 medium containing 50 IU ml–1 rhIL-2 every 2 days. Cells were collected and analysed by flow cytometry and immunoblot analyses as indicated in the figure legends. Intracellular staining for cytokines (for example, IFNγ) or GZMB in human CD8+ T cells cultured under both acute and chronic stimulation conditions was performed after stimulation with ionomycin and phorbol 12-myristate 13-acetate (PMA) in the presence of GolgiStop (monensin) for 4 h.

Fresh human blood leukopaks from healthy donors were obtained from the Blood Donor Center at St. Jude Children’s Research Hospital. Ethical oversight for studies involving human specimens was provided by the Institutional Review Board (IRB) of St. Jude Children’s Research Hospital. As all leukapheresis products were de-identified, the isolation of naive CD8+ T cells and related experiments did not constitute human-subjects research.

Ex vivo and in vivo killing assays

For ex vivo killing assay, splenocytes from naive CD45.2+ C57BL/6 mice were pulsed with 0.2 µM gp33–41 peptide (target) or the irrelevant OVA257–264 SIINFEKL peptide (non-target) at 37 °C for 1 h. Target and non-target cells were labelled with 0.5 μM Cell Trace Violet (CTV; Thermo Fisher Scientific) or 5 μM CTV, respectively, per the manufacturer’s instructions. Target (CTVlow) and non-target (CTVhi) cells were mixed at a 1:1 ratio and incubated with or without sgNTC and sgZmynd8-expressing Texprog (Ly108+CX3CR1–), effector-like (Ly108–CX3CR1+) and Texterm (Ly108–CX3CR1–) subpopulations (sorted from the spleen of the same host at 21 dpi (from the dual-colour transfer system)) at a 1:3 effector-to-target ratio for 16 h in T cell medium as described11. Percentage of specific lysis was calculated as follows: specific lysis (%) = 100 – (100 × percentage of gp33-pulsed targets remaining after co-culture with effectors)/(percentage of gp33-pulsed targets after culture without effectors).

In vivo killing assays were performed as previously described22. In brief, CD45.2+ splenocytes were pulsed with 0.2 µM gp33–41 peptide or PBS at 37 °C for 1 h. These antigen- or PBS-pulsed splenocytes were then labelled with 0.5 μM CTV (CTVlow) or 5 μM CTV (CTVhi), respectively, at 37 °C for 15 min. At 21 (for Fig. 2h), 36 (for Fig. 2j) or 28 (for Fig. 5p) dpi, the CTVlow and CTVhi splenocytes were mixed at a 1:1 ratio, and a total of 2 × 107 cells were adoptively transferred to LCMV Cl13-infected mice that received sgNTC or sgZmynd8 (Ametrine+)-expressing cells (single-colour transfer system), followed by analysis of in vivo cytotoxicity against these splenocytes after 3 h.

Plasmid generation

To generate ZMYND8-V5 truncation constructs, the wild-type ZMYND8-V5 plasmid (Addgene #65401) was used as the template. All truncations were generated using the Q5 Site-Directed Mutagenesis Kit (E0554S, NEB) according to the manufacturer’s instructions. The primers used for each truncation were as follows: ΔPHD-F: ATTCCGTCCATCCTG, ΔPHD-R: ACAGTAGCAGAATGCATC; ΔBRD-F: TTTACTCTGGGTCTCG, ΔBRD-R: GAAGTATGTCCAGAATGTTATC; ΔPWWP-F: ATTGCTACAAGGCTCAC, ΔPWWP-R: ATTCCTTTTTCTGTGAAAAAG; ΔPHD–BRD–PWWP-F: ATTCCGTCCATCCTG, ΔPBP-R: ATTCCTTTTTCTGTGAAAAAG; ΔMYND-F: CCACTGCTTCTTCTTG, ΔMYND-R: ACCCAGTCAGCTACTG.

Immunoprecipitation and immunoblot analyses

For immunoprecipitation in Extended Data Fig. 9m, 2 × 107 activated CD8+ T cells were lysed in ice-cold Pierce IP Lysis Buffer (87787, Thermo Fisher Scientific) supplemented with protease and phosphatase inhibitor cocktail (78442, Thermo Fisher Scientific). The cell lysates were then incubated with 2 µg of anti-ZMYND8 (11633-1-AP, Proteintech) or normal rabbit IgG (2729, Cell Signalling Technology) antibody, with rotation overnight at 4 °C, followed by incubation with Protein A/G magnetic beads (88802, Thermo Fisher Scientific) for 3 h. The beads were washed 3 times with ice-cold IP lysis buffer, resuspended with 1× Laemmli sample buffer (1610747, Bio-Rad), and then boiled at 95 °C for 10 min, followed by immunoblot analysis.

For immunoprecipitation in Extended Data Fig. 9p, HEK293T cells (4 × 105) were seeded in each well of a 6-well plate, and plasmids were transfected when the cells reached approximately 80% confluency. In brief, wild-type or truncated ZMYND8-V5 constructs, together with 5 μg pcDNA3.1-p300-6×His, were mixed with TransIT-293 (MIR 2706, Mirus Bio) in 200 μl Opti-MEM medium (31985, Gibco) for each well. The total amount of each ZMYND8-V5 truncation construct was optimized to achieve comparable expression (0.5 μg for wild-type and ΔMYND, 0.6 μg for ΔPHD, ΔBRD and ΔPWWP, and 0.8 μg for ΔPHD–BRD–PWWP). At 36 h after transfection, HEK293T cells were lysed in ice-cold Pierce IP Lysis Buffer containing protease and phosphatase inhibitor cocktail with rotation at 4 °C for 30 min. The cell lysate was centrifuged at 13,000g for 10 min at 4 °C, and the supernatant was incubated with anti-V5 magnetic beads (SAE0203, Sigma-Aldrich) at 4 °C for 2 h. Beads were washed 3 times with ice-cold IP Lysis Buffer and resuspended with 1× complete Laemmli sample buffer. All the protein samples were boiled at 95 °C for 10 min, and then separated for immunoblot analysis.

For immunoblot analysis, cells were lysed in RIPA buffer (Thermo Fisher Scientific) supplemented with protease and phosphatase inhibitor cocktail. The protein concentrations of cell lysates were determined by BCA protein assay kit (Thermo Fisher Scientific). Equivalent amounts of total protein were denatured by adding Laemmli protein sample buffer (Bio-Rad) and boiling at 95 °C for 5 min, and then separated using 4–12% Criterion XT Bis-Tris protein gel (3450125, Bio-Rad) and transferred to polyvinylidene fluoride (PVDF) membranes (1620177, Bio-Rad). The membranes were blocked using 3% Bovine Serum Albumin (BSA) (A9418, Sigma-Aldrich) for 1 h at room temperature and then incubated overnight with primary antibodies at 4 °C. The membranes were washed three times with Tris-buffered saline containing 0.1% Tween-20 (TBST) and then incubated with secondary antibodies for 2 h at room temperature. After washing three times with TBST, HRP was activated with SuperSignal West Dura Extended Duration Substrate (34075, Thermo Fisher Scientific) and visualized with chemiluminscent detection system using Amersham Imager 600 (GE Healthcare Life Sciences). The blots were then processed and quantified using Image J software.

Primary antibodies and dilutions were as follows: anti-ZMYND8 (1:1,000, 11633-1-AP) and anti-V5 tag (1:3,000, 14440-1-AP) were from Proteintech; anti-6× His tag (1:1,000, ab18184) was from Abcam; anti-phospho-STAT5 (Y694) (1:1,000, 9351S), anti-STAT5 (1:1,000, 94205S), anti-STAT5B (1:1,000, 34662S), anti-IL-2Rα/CD25 (1:1,000, 36128S), anti-p300 (1:1,000, 57625S), anti-GAPDH (1:5,000, 2118S) and anti-β-Actin (called ACTB;1:5,000, 4970) were from Cell Signalling Technology. Secondary antibodies and dilutions were as follows: HRP-conjugated anti-rabbit IgG (H + L) (1:3,000, W4011) and HRP-conjugated anti-mouse IgG (H + L) (1:3,000; W4021) were from Promega, and HRP-conjugated anti-rabbit IgG, light chain specific (1:3,000; SA00001-7L) was from Proteintech. Densitometric quantification of phosphorylated protein levels was normalized relative to the corresponding total protein, and densitometric quantification of total protein expression was normalized relative to the loading control ACTB. All densitometric quantifications depict the fold changes compared with the relative control (set equal to 1.0) and are shown below the immunoblot image.

RNA isolation and gene expression profiling

Cells were lysed with Buffer RLT in the RNeasy Mini Kit (QIAGEN), and total RNA was extracted according to the manufacturer’s instructions. Then, 1 μg total RNA was reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). The cDNA was then diluted and added to Power SYBR Green Master Mix (Applied Biosystems) containing gene-specific PCR primers. Gene amplification was assessed using QuantStudio7 Flex Real-Time PCR System (Applied Biosystems). Actb was used as the housekeeping control. A list of the primers is provided in Supplementary Table 12.

Luciferase assay

pGL4.23-IL2RA CaRE4 scramble (#91852), pGL4.23-IL2RA CaRE4 (#91850), GFP-ZMYND8 (#65401) and pcDNA3.1-p300 (#23252) were obtained from Addgene, and pTK-Green Renilla Luc Vector (16154) was from Thermo Fisher Scientific. Among them, pGL4.23-IL2RA CaRE4 scramble and pGL4.23-IL2RA CaRE4 plasmids contain a scrambled sequence and the IL2RA enhancer CaRE4 sequence, respectively, both upstream of a generic minimal promoter28. For the experiments shown in Fig. 4f and Extended Data Fig. 9o, each Firefly luciferase (Luc) IL2RA CaRE4 or scramble construct (500 ng) and Renilla Luc plasmid (70 ng) were electroporated with or without p300-expressing plasmid (500 ng) alone or together with wild-type or indicated mutant ZMYND8-expressing plasmid (500 ng) into 5 × 105 Jurkat cells using the 4-D Nucleofector (with program CL-120) and 20 μl Nucleofection Buffer SE (V4XC-1032, Lonza). Jurkat cells were rested for 18 h and then split into either an untreated control plate or stimulation plate pre-coated with anti-human CD3 (clone OKT3, 10 μg ml−1, BioLegend) and anti-human CD28 (clone CD28.2, 10 μg ml−1, BioLegend) antibodies. Luciferase expression was assessed using the Dual-Glo Luciferase Assay (E2920, Promega) on a 96-well plate luminometer after 24 h of stimulation. Firefly Luc activity was normalized to Renilla Luc activity for each well and was reported as fold induction over pGL4.23-IL2RA scramble vector under unstimulated condition.

CUT&RUN assay

Sample preparation and sequencing

Total Cas9+ P14 cells transduced with sgNTC (Ametrine+) or sgZmynd8 (GFP+) were sorted from the spleen of LCMV Cl13-infected recipient mice at 7 dpi (due to abundant expression of IL-2R at this time point (Extended Data Fig. 1k,l)), or 3 Tex subpopulations (Ly108+CX3CR1−, Ly108−CX3CR1+ and Ly108−CX3CR1−) among control (sgNTC-expressing) P14 cells were sorted at 21 dpi. A total of 0.5–1 × 105 cells were used for CUT&RUN using the CUTANA ChIC/CUT&RUN Kit (EpiCypher) according to the manufacturer’s instructions. The antibodies (0.5 μg per reaction) used for CUT&RUN were as follows: anti-ZMYND8 (11633-1-AP) was from Proteintech; Rabbit IgG negative control antibody (13-0042) and anti-H3K4me3 (13-0041) were from EpiCypher; anti-H3K4me1 (ab176877), anti-H3K36me2 (ab9049), anti-H3K14Ac (ab52946), anti-H3K27Ac (ab4729) and anti-H4K16Ac (ab109463) were from Abcam. anti-p300 (57625S) was from Cell Signalling Technology. Here is the detailed information about the biological replicates for CUT&RUN samples: for Fig. 4d and Extended Data Fig. 9a, IgG (n = 2), anti-ZMYND8 (n = 3) and anti-p300 (n = 2); for Fig. 4c and Extended Data Fig. 9d (n = 2 for all histone modification samples). Representative genome tracks from one biological replicate are shown; for Fig. 4e and Extended Data Fig. 9j, n = 2 for each antibody (anti-H3K27Ac, anti-ZMYND8 and anti-p300) in either sgNTC or sgZmynd8-expressing cells. Representative genome tracks from one biological replicate are shown; for Extended Data Fig. 9e, Texprog (n = 1), effector-like (n = 2) and Texterm (n = 2). CUT&RUN-enriched DNA from H3K27Ac, ZMYND8 or p300 CUT&RUN assays was quantified by qPCR in Extended Data Fig. 9k,l using specific primers, as previously described49 (Supplementary Table 12). The Actb gene sequence was used as control genomic locus. The CUT&RUN–qPCR data was normalized and analysed using the comparative CT method (also known as 2–ΔΔCT method), as previously described49. Primer sequences used in CUT&RUN–qPCR are provided in Supplementary Table 12. Alternatively, CUT&RUN libraries were prepared using CUTANA CUT&RUN Library Prep Kit (EpiCypher) according to the manufacturer’s protocol. Barcoded libraries were quantified on an Agilent TapeStation. The final libraries were sequenced on the Illumina NovaSeq platform using paired-end (2× 50 bp) with target reads of 20 million per sample. Representative in-house generated raw and processed CUT&RUN assay data shown in Fig. 4c–e and Extended Data Fig. 9a,d,e,j have been deposited into the GEO database with the Superseries identifier GSE342764.

Data analysis

CUT&RUN raw reads were processed using nf-core/cutandrun pipeline50. The peaks for the histone marks, ZMYND8 and p300 binding peaks were called by seacr51 (for histone marks) or MACS252 (for ZMYND8 and p300) algorithms. Genome annotation of binding sites was performed by plotAnnoBar function in ChIPseeker R package53 (v1.40.0). The numbers of intersected peak regions were calculated by enrichPeakOverlap function in ChIPseeker. ZMYND8 binding sites shown in Extended Data Fig. 9a were identified in at least two of three CUT&RUN samples using anti-ZMYND8 in P14 cells compared with isotype control. In addition, a two-tailed Fisher’s exact test was used to assess whether an MSigDB gene set was significantly enriched (P < 0.05) among genes nearest to ZMYND8 binding sites. Tracks were visualized using Integrative Genomics Viewer (IGV, v2.4.13). For Cistrome transcriptional regulator binding or histone mark analysis54, ZMYND8-bound regions were uploaded to http://dbtoolkit.cistrome.org/ to analyse transcriptional regulators (including transcription factors and chromatin regulators) or histone marks with significant binding overlaps using default parameters. For comparing H3K27Ac level in Texprog, effector-like and Texterm cells, consensus peak regions were generated by concatenating the H3K27Ac peak files from all samples, sorting the resulting genomic intervals, and merging overlapping or adjacent peaks using bedtools software (v2.25.0). Read counts over the consensus peak regions were then quantified using bedtools ‘multicov’ command, which calculated the number of sequencing reads overlapping each peak from the aligned BAM file of each sample. The resulting peak-by-sample count matrix was used for downstream quantitative and differential analysis using DESeq2 R package55 (v1.32.0). Normalized average H3K27Ac read counts at the ZMYND8-bound active enhancer region of the Il2ra locus were visualized by ComplexHeatmap R package (v2.20.0). The code for analysis of CUT&RUN data in the relevant figure panels has been deposited to Zenodo (https://doi.org/10.5281/zenodo.21924005 (ref. 56)).

scRNA-seq

Sample preparation

Cas9-expressing P14 cells transduced with either sgNTC (Ametrine+) or sgZmynd8 (GFP+) were mixed at a 1:1 ratio and then injected intravenously into the same Cas9+ recipient mice, followed by LCMV Cl13 infection (n = 2 per group). sgNTC and sgZmynd8-transduced Cas9+ P14 cells were sorted from the same host at 21 dpi. After cell counting and centrifugation at 2,000 rpm for 5 min, the supernatant was removed, and cells were resuspended and diluted in 1× PBS containing 0.04% BSA at concentration of 1 × 106 cells per ml. Single-cell libraries were prepared using a Chromium Single Cell 3′ Library and Gel Bead kit (v3.1; 10X Genomics). In brief, the single-cell suspensions were loaded onto the Chromium Controller according to their respective cell counts to generate 9,000 single-cell gel beads in emulsion per sample. Each sample was loaded into a separate channel. The cDNA content of each sample after cDNA amplification of 12 cycles was quantified and quality checked using a High Sensitivity D5000 chip in a TapeStation (Agilent Technologies) to determine the number of PCR amplification cycles to produce a sufficient library for sequencing. After library quantification and quality checking using a D5000 chip (Agilent Technologies), samples were diluted to 3.5 nM for loading onto a HiSeq 4000 (Illumina) with a 2× 100-bp paired-end kit using the following cycles: 28 cycles read 1, 10 cycles i7 index, 10 cycles i5 index and 90 cycles read 2. An average of 300 million reads per sample was obtained (approximately 20,000 reads per cell). In-house generated raw and processed scRNA-seq data have been in the NCBI GEO database and are accessible through the GEO SuperSeries access number GSE342764.

Data analysis

FASTQ files were processed using Cell Ranger57 (v7.1.0) using the Cell Ranger count command with default settings. Gene expression reads were aligned to the mouse genome (mm10 from ENSEMBL GRCm38 loaded from 10X Genomics). Underlying cell variations derived in P14 cells in the single-cell gene expression data were visualized using a two-dimensional projection by UMAP with the Seurat R package58 (v5.1.0). sgNTC and sgZmynd8-transduced Cas9+ P14 cells were further clustered and annotated as four cellular states (Texprog, Texint, TexKLR and Texterm): Tcf7+Slamf6+ (Texprog), Cx3cr1+Mki67+Klrg1low (Texint), Cx3cr1+Klrg1hiKlre1hiKlrc1hiKlrd1hi (TexKLR) and Cx3cr1–Cd101+ (Texterm). Violin and dot plots that depict the expression levels of selective genes were generated using the VlnPlot and DotPlot function, respectively, in the Seurat R package. Activity scores of gene signatures curated from public gene sets or data generated in-house (see below for details) were calculated using the AddModuleScore function in Seurat. Ahmed CXCR5+ stem-like CD8+ T cell59 and Ahmed CXCR5– terminally differentiated CD8+ T cell59 signatures were curated by comparing CXCR5+CD8+ T cells with TIM-3+CD8+ T cells from LCMV Cl13-infected mice (GSE84105); the gene signatures were generated using the top 200 upregulated genes and top 200 downregulated genes (ranked by log2FCs), respectively. The Kaech effector and memory signatures60 were curated by comparing IL-7Rlow with IL-7Rhi effector CD8+ T cells from microarray analysis (GSE8678); the Kaech effector gene signature was generated using the top 200 upregulated genes (ranked by log2FCs) followed by removal of probes without gene names, while the Kaech memory gene signature was generated using the top 200 downregulated genes (ranked by log2FCs) followed by removal of probes without gene names. The Regev cell cycle signature was previously described61. The core tissue-resident memory T cell signature was previously described62. The STAT5CA upregulated (Up) and downregulated (Down) gene signatures were curated from a public scRNA-seq dataset of STAT5CA-expressing versus control CD8+ T cells (GSE214116)21 using genes with log2FC (STAT5CA versus control) >1 (Up) or <–1 (Down) and Bonferroni corrected P < 0.05. The in-house ZMYND8-activated signature was generated using downregulated genes (log2FC <–0.5; Bonferroni corrected P < 0.05) in sgZmynd8-expressing Havcr2 (encodes TIM-3)+ P14 cells versus sgNTC-expressing Havcr2+ P14 cells from scRNA-seq profiling at 21 dpi. The ZMYND8-suppressed signature was generated using upregulated genes (log2FC > 0.5; Bonferroni corrected P < 0.05) in sgZmynd8-expressing Havcr2+ P14 cells versus sgNTC-expressing Havcr2+ P14 cells from scRNA-seq profiling at 21 dpi. Epigenetic landscape in silico deletion analysis (LISA)63 (https://lisa.cistrome.org/) was performed using the top 250 upregulated genes (ranked by log2FC) in sgZmynd8-expressing compared with sgNTC-expressing total P14 cells to infer the transcription factors with upregulated activity upon ZMYND8 deficiency. Pseudotime trajectory analysis was performed to infer the differentiation trajectory of Tex cells in sgNTC and sgZmynd8-expressing P14 cells. The analysis was conducted (using the default parameters in the Monocle3 R package64 (v1.3.7)) on the four Tex states, with the Texprog state set as the starting point. Density plots were used to compare pseudotime distribution between genotypes or Tex differentiation states. In Extended Data Fig. 3f, the region between the dashed lines denotes the interval in which sgZmynd8-expressing P14 cells accumulated most prominently relative to sgNTC controls. Consistent with the inferred trajectory, sgZmynd8-expressing cells were enriched primarily in the TexKLR state, and to a lesser extent the Texint state. The code for analysis of scRNA-seq data in the relevant figure panels has been deposited to Zenodo (https://doi.org/10.5281/zenodo.21924005 (ref. 56)).

Pre-ranked GSEA

For scRNA-seq analysis, to compare gene expression between genotypes (sgZmynd8-expressing compared with sgNTC-expressing), a non-parametric two-tailed Wilcoxon rank-sum test was applied, and genes were ranked by log2FC values. GSEA (v4.2.3) analysis of the STAT5CA Up signature in sgZmynd8-expressing P14 compared with sgNTC cells was used to derive leading-edge genes65, and those showing significant upregulation (log2FC > 0.5, adjusted P < 0.05) in sgZmynd8-expressing cells are shown in the heatmap. For pathway enrichment analysis, pre-ranked GSEA (an analysis of GSEA against a user-supplied, ranked list of genes) was then performed using the MSigDB collection (v7.4) for each comparison65.

Public dataset analysis

Multiple public scRNA-seq datasets from the GEO databases were re-analysed to examine the correlation of Zmynd8 (mouse) or ZMYND8 (human) expression and ZMYND8-activated and ZMYND8-suppressed activity scores (described above) with CD8+ T cell exhaustion. Seurat R package (v5.1.0) was used for preprocessing and visualization, similar to that used for the in-house generated data. Zmynd8 expression in endogenous H2Db-gp33-specific CD8+ T cells from early and late stages of acute and chronic infection66 (Fig. 5a) and Tex states from chronic infection15 (GSE122712; Extended Data Fig. 11c) were visualized using the DotPlot function in Seurat. ZMYND8-activated and ZMYND8-suppressed activity scores in Tex states from chronic infection15 (GSE122712) were visualized using the VlnPlot function in Seurat. Zmynd8 expression in OT-I cells from B16-OVA melanoma31 (GSE216909) was visualized using the DotPlot function in Seurat. ZMYND8-activated and ZMYND8-suppressed activity scores in Tex states from B16-OVA melanoma31 (GSE216909) were visualized using the VlnPlot function in Seurat. For scRNA-seq datasets from a genetically engineered mouse model (GEMM) for lung cancer32 (GSE164177), ZMYND8-activated and ZMYND8-suppressed activity scores in CD8+ T cells were visualized using the VlnPlot function in Seurat. For the RNA-seq dataset from a GEMM for liver cancer33 (GSE89307), the relative expression of Tcf7, Pdcd1, Tox and the average expression of ZMYND8-activated or ZMYND8-suppressed genes of tumour-specific CD8+ T cells were visualized using the Heatmap function in the ComplexHeatmap R package (v2.20.0). For the dataset from human patients infected with HIV30 (GSE157829), ZMYND8 expression and ZMYND8-activated and ZMYND8-suppressed activity scores were examined in CD8+ T cells from the peripheral blood of healthy donor and HIV-infected individuals with low and high viral titre (as previously defined30). In the human melanoma dataset34 (GSE123139), the naive-like, transitional and dysfunctional CD8+ T cell annotations were based on the reported markers in each subpopulation31. ZMYND8 expression and the activity scores for ZMYND8-activated and ZMYND8-suppressed signatures were examined in these subpopulations.

To assess the correlation of the responsiveness to ICB with ZMYND8 activity in CD8+ T cells from human melanoma41 (GSE120575), the Kendall rank order correlation between ZMYND8 expression or the average expression of ZMYND8-activated genes and other reported markers that are positively associated (IL7R, SELL, TCF7) or negatively associated (HOPX, LGALS1, VCAM1, SNAP47, CCL3, FASLG, MT2A, EPSTI1, GBP1, PSMB2, NDUFB3, CD38, GBP4, WARS, PRDX3) with ICB response was performed in CD8+ T cells in patients with melanoma treated with ICB. For other skin cancers, such as advanced basal cell carcinoma (BCC)39 (GSE123813) and squamous cell carcinoma (SCC)39 (GSE123813), ZMYND8 expression and the activity scores of ZMYND8-activated and ZMYND8-suppressed signatures were compared using violin plots in the CD8+ T cell clusters (originally annotated in the literature39) after ICB treatment. For colorectal cancer (GSE205506)40, the ZMYND8-activated and ZMYND8-suppressed activity scores were compared in intratumoural CD8+ T cells from patients who achieved pathological complete response (pCR) or non-pCR after ICB treatment, as well as untreated patients.

To assess the correlation of the responsiveness to IL-2 therapy with ZMYND8 activity in CD8+ T cells during chronic infection, the activity scores of the ZMYND8-activated and ZMYND8-suppressed signatures were compared in P14 cells from LCMV Cl13-infected mice treated with or without IL-2 (GSE206732)24. For tumour models, the activity scores of ZMYND8-activated and ZMYND8-suppressed signatures were compared in CD8+ T cells from B16F10-B2m–/– melanoma treated with vehicle and mRNA-encoded IL-237 or from T3 sarcoma tumours at day 2 after treatment with vehicle or IL-2 (GSE252650)38.

Single-cell multiome profiling

For multiome analysis, sgNTC and sgZmynd8-expressing Cas9+ P14 cells were sort-purified from the spleens of recipient mice at day 21 post-LCMV Cl13 infection (n =  2 per group). All samples were centrifuged at 2,000 rpm for 5 min at 4 °C. The supernatant was removed, and the pellets were resuspended in 50 μl 1× PBS plus 0.04% BSA. Nuclei for Single Cell Multiome ATAC + Gene Expression Sequencing were isolated, washed, and counted per manufacturer’s instructions (10X Genomics). Single nuclei suspensions were loaded onto the Chromium Controller according to their respective cell counts to generate single nuclei GEMs per the manufacturer’s protocol. Each sample was loaded into a separate channel. Libraries were prepared using the Chromium Next GEM Single Cell Multiome ATAC + Gene Expression Reagent Bundle (10X Genomics). The cDNA content of each sample was amplified (7 cycles for ATAC library, 12 cycles for Gene Expression library), and then quantified and quality checked using a High Sensitivity DNA chip with a TapeStation 4200 analyser (Agilent Technologies). Samples for ATAC library sequencing were diluted to 150 pM for loading onto the NovaSeq (Illumina) with a 2× 100 paired-end kit using the following read cycles: 50 cycles Read 1 N, 8 cycles i7 Index, 24 cycles i5 Index, and 49 cycles Read 2 N. An average of 343,111,424 reads per sample was obtained (~45,285 read pairs per nucleus). Samples for Gene Expression library sequencing were diluted to 150 pM for loading onto the NovaSeq (Illumina) with a 2× 100 paired-end kit using the following read cycles: 28 cycles Read 1, 10 cycles i7 Index, 10 cycles i5 Index, and 90 cycles Read 2 N. An average of 439,208,964 reads per sample was obtained (~57,979 read pairs per nucleus).

For single-nuclear RNA-seq (snRNA-seq) analysis from multiome profiling, the Cell Ranger ARC v2.0.2 Single-Cell Software Suite (10X Genomics) was implemented to process the raw sequencing data from the Illumina HiSeq run. This pipeline performed de-multiplexing, alignment (mm10), and barcode processing to generate gene-cell and peak-cell matrices used for downstream gene expression and ATAC analysis, respectively. Cells with low or high unique molecular identifier (UMI) counts were filtered. A total of 24,160 cells (sgNTC replicate 1: 4,764; sgNTC replicate 2: 7,142; sgZmynd8 replicate 1: 5,241; and sgZmynd8 replicate 2: 7,013) were captured with an average of 363 mRNA molecules (UMIs, median: 327, range: 196–1,770). The expression level of each gene was normalized using the NormalizeData function with a scale factor of 106. In-house generated processed multiomics data have been deposited in the NCBI GEO database and are accessible through the GEO SuperSeries access number GSE342764.

Sample merging and processing in scATAC–seq

ATAC peaks from each sample were merged to create a common peak set and quantified by Signac R package (v1.14.0). Specifically, peak coordinates for each sample were loaded and converted to genomic ranges. The ‘reduce’ function in GenomicRanges R package (v1.55.4) was used to first create a common set of peaks. Fragment objects were created using the CreateFragmentObject function for each sample to quantify peaks using the FeatureMatrix function. Quantified matrices were used to create a Seurat object for each sample, and the standard merge function was then used to merge the objects. Normalization and linear dimensional reduction were performed on the merged single-cell ATAC–seq (scATAC–seq) dataset through latent semantic indexing using RUNTFIDF, FindTopFeatures, and RunSVD functions with default parameters. The scATAC–seq dataset was then integrated with snRNA-seq data through the corresponding cell barcode for each cell. Using the weighted nearest-neighbour methods in the Seurat R package, a joint neighbour graph that represents both the gene expression and DNA accessibility measurements was computed by FindMultiModalNeighbors function. CD8+ T cell states were annotated by their markers similar as the scRNA-seq analysis.

Differential accessibility, motif enrichment analysis

Differentially accessible peaks between cell types or genotypes were calculated by the FindMarkers function with min.pct = 0.1. Transcription factor motifs were identified using the FindMotifs function based on the differentially upregulated and downregulated peaks. Additionally, we also computed a per-cell motif activity score by running ChromVAR (runChromVAR function) in the Signac R package (v1.14.0) and directly tested for differential activity scores between genotypes in P14 cells or the indicated Tex cell states using the FindMarkers function. The code for analysis of multiomics data in the relevant figure panels has been deposited to Zenodo (https://doi.org/10.5281/zenodo.21924005 (ref. 56)).

ATAC–seq

Sample preparation

Cas9-expressing P14 cells transduced with either sgNTC (Ametrine+) or sgZmynd8 (GFP+) were mixed at a 1:1 ratio and then injected intravenously into the same Cas9+ recipient mice, followed by LCMV Cl13 infection. At 14 dpi, Texprog (Ly108+TIM-3–) and effector-like (Ly108–TIM-3+) cells were sorted from the same host for ATAC–seq analysis (n = 4 biological replicates per group). Sorted cells were incubated in 50 µl ATAC–seq lysis buffer (10 mM Tris-HCl, pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% IGEPAL CA-630) on ice for 10 min. The resulting nuclei were pelleted at 500g for 10 min at 4 °C. The supernatant was carefully removed with a pipette and discarded. The pellet was resuspended in 50 µl transposase reaction mix (25 µl 2× TD buffer, 22.5 µl nuclease-free water and 2.5 µl transposase) and incubated for 30 min at 37 °C. After the reaction, the DNA was cleaned up using the QIAGEN MinElute kit. The barcoding reaction was run using the NEBNext HiFi kit based on manufacturer’s instructions and amplified for five cycles as described19,22 using the same primers. The optimal cycle numbers were assessed from 5 µl (of 50 µl) from the previous reaction mix using KAPA SYBRFast (Kapa Biosystems) and a 20-cycle amplification on an Applied Biosystems 7900HT. Optimal cycles were determined from the linear part of the amplification curve, and the remaining 45 µl of PCR reaction was amplified in the same reaction mix using the optimal cycle number.

Data analysis

ATAC–seq analysis was performed as previously described19,22. In brief, 2× 50 bp paired-end reads from NovaSeq were trimmed for Nextera adapters using Trimmomatic (v0.36; paired-end mode, parameters: LEADING:10 TRAILING:10 SLIDINGWINDOW:4:18 MINLEN:25) and aligned to the mouse genome mm10 with BWA (v0.7.16, default parameters). Duplicates were marked using Picard (v2.9.4), and only non-duplicated, properly paired reads were retained with SAMtools (-q 1 -F 1804, v1.9). To account for Tn5 transposase shift, reads were offset by +4 bp (sense strand) and –5 bp (antisense strand), then separated into nucleosome-free, mono-, di-, and tri-nucleosome fractions by fragment size as described67. BigWig files were generated using the central 80 bp of fragments, scaled to 3 × 107 nucleosome-free reads. Clear nucleosome-free peaks and mono-, di-, and tri-nucleosome patterns were observed in IGV (v2.4.13). All samples yielded ~2 × 108 nucleosome-free reads, indicating high data quality. Next, peaks were called on nucleosome-free reads using MACS2 (v2.1.1.20160309, parameters: --extsize 200 --nomodel). To ensure reproducibility, peaks were retained only if called with a stricter cutoff (MACS2 -q 0.05). Consensus peaks were defined as those present in ≥50% of replicates, with non-reproducible peaks discarded. Between sgNTC and sgZmynd8-transduced Texprog and effector-like cells, reproducible peaks overlapping by ≥100 bp were merged. Read counts for each region were obtained with bedtools (v2.25.0).

For differential accessibility analysis, nucleosome-free reads were normalized to counts per million, and differences were assessed using a negative binomial model implemented in DESeq2 R package (v1.32.0)55. Differentially accessible open chromatin regions (OCRs) were defined as those with P < 0.05 and |log2FC|> 0.5. PCA was performed with the prcomp function in R. Differential accessibility regions were assigned to the nearest genes using HOMER (v4.9.1) software68, and functional enrichment was assessed with MSigDB signatures69 by a two-tailed Fisher’s exact test. For motif analysis, 1,000 unchanged regions (P > 0.5) were used as background. Motifs were scanned using FIMO from the MEME suite70 (v4.11.3; parameters: --thresh 1e-4 --motif-pseudo 0.0001) against the TRANSFAC 2019 Vertebrata database. Enrichment in differential accessible OCRs versus background was evaluated with two-tailed Fisher’s exact tests. For transcription factor footprinting, binding activity was inferred and visualized using RGT-HINT71 (v0.13.2). For Cistrome transcriptional regulator binding analysis, OCRs with increased accessibility (P < 0.05 and log2FC > 0.5) in sgZmynd8-expressing Texprog and effector-like cells compared to sgNTC counterparts were uploaded to http://dbtoolkit.cistrome.org/ to analyse transcriptional regulators (including transcription factors and chromatin regulators) with significant binding overlaps using default parameters. Genome tracks of average ATAC–seq signals (for each genotype) in indicated gene loci were presented using Integrative Genomics Viewer (IGV, v2.4.13). In-house generated raw and processed ATAC–seq data have been deposited in the NCBI GEO database and are accessible through the GEO SuperSeries access number GSE342764. The code for analysis of ATAC–seq data in the relevant figure panels has been deposited to Zenodo (https://doi.org/10.5281/zenodo.21924005 (ref. 56)).

In vivo single-cell and bulk CRISPR screening

Selection of epigenetic factors for library design

To select the epigenetic factors that were potentially involved in CD8+ T cell exhaustion in the chronic infection, we performed differential gene expression analyses from public scRNA-seq11,15 (GSE149876 and GSE122712) and RNA-seq15 (GSE123235) datasets and differential accessibility analysis of OCRs in a scATAC–seq dataset16 (GSE230363), to nominate genes with differential expression/accessibility (threshold: log2FC > 0.3, P < 0.05 for Up; log2FC < –0.3, P < 0.05 for Down) between different Tex states (Texterm versus Texprog, Texterm versus effector-like or Texprog versus effector-like). Those genes with differential expression or accessibility were overlapped with two published gene lists16,72 of epigenetic factors to select a total of 91 epigenetic factors. Nine transcription factors (Bach273, Batf17,18,19, Myb74, Prdm175, Tbx2176, Tcf777,78, Tox4,5,6,7,8, Tox28 and Zeb279,80) known to regulate Tex cell differentiation were also included in the custom library for a total of 100 genes targeted (Supplementary Table 1).

Sample preparation

The in vivo screening approach was modified based on previous studies19,31. In brief, retrovirus was produced by co-transfecting the retroviral library with pCL-Eco (Addgene, #12371) in Plat-E cells. 48 h after transfection, the supernatant containing viral particles was collected and frozen at −80 °C. Cas9-expressing P14 cells were transduced to achieve 20–30 % transduction efficiency. Transduced cells were sorted based on the expression of Ametrine, and an aliquot of 1 × 106 transduced Cas9+ P14 cells was saved as ‘input’. Transduced Cas9+ P14 cells (1 × 104) were then transferred intravenously to Cas9+ mice followed by LCMV Cl13 infection (2 × 106 PFU) one day later. A total of 60 recipient mice were used in 2 screens combined (in Fig. 1a). For scCRISPR screening, donor-derived total P14 cells from a total of 15 Cas9+ mice were sorted and pooled for scCRISPR analysis at 28 dpi. In total, five 10X reactions (Chromium Next GEM Single Cell 5’ Kit v2, PN-1000263 and 5’ CRISPR Kit, PN-1000451) were used. In-house generated raw and processed scCRISPR screening data have been deposited in the NCBI GEO database and are accessible through the GEO SuperSeries access number GSE342764. For bulk CRISPR screening, donor-derived Texprog (Ly108+CX3CR1–), effector-like (Ly108–CX3CR1+) and Texterm (Ly108–CX3CR1–) P14 subpopulations were sorted at 28 dpi and frozen at −80 °C prior to genomic DNA extraction. At least 5 × 104 sorted Tex subpopulations (> 150× cell coverage per sgRNA) were used for deep sequencing analysis. For scCRISPR screening of IL-2 signalling regulators (Extended Data Fig. 1m), an in vivo scCRISPR screen targeting known positive regulators (Jak3, Stat5a and Stat5b) and negative regulators (Socs1 and Socs3) of IL-2 signalling (along with sgNTCs and additional validation controls for the screening phenotypes) was performed, using a similar strategy as described in Fig. 1a. The sgRNA library contained 3 sgRNAs targeting each of the IL-2 signalling genes. In-house generated processed scCRISPR screening data in Extended Data Fig. 1m have been deposited into Zenodo (https://doi.org/10.5281/zenodo.21909366 (ref. 81)).

Library preparation for scCRISPR screening

Sorted P14 cells were resuspended and diluted in 1× PBS (Thermo Fisher Scientific) containing 0.04% BSA (Amresco) at concentration of 1 × 106 cells ml–1. Both the gene expression library and the CRISPR screening library were prepared using the Chromium Next GEM Single Cell 5’ v2 kit and 5’ CRISPR Kit for CRISPR Screening (10X Genomics). In brief, the single-cell suspensions were loaded onto the Chromium Controller according to their respective cell counts to generate 10,000 single-cell gel beads in emulsion (GEMs) per sample. Each sample was loaded into four separate channels. The resulting libraries were quantified, and quality checked by TapeStation (Agilent). Samples were diluted and loaded onto the NovaSeq (Illumina) to a sequencing depth of 300 million reads per channel for gene expression libraries and 200 million reads per channel for CRISPR screening libraries.

Data preprocessing

Alignments and count aggregation of gene expression and sgRNA reads were completed using Cell Ranger57 (v7.1.0). Gene expression and sgRNA reads were aligned using the cellranger count command with default settings. Gene expression reads were aligned to the mouse genome (mm10 from ENSEMBL GRCm38 loaded from 10X Genomics). sgRNA reads were aligned to sgRNA library using the pattern TATTTCTAGCTCTAAAAC(BC) to capture sgRNA sequences. Only droplets with ≥2 sgRNA UMIs were used in further analyses. The filtered feature matrices were imported to create assays for a Seurat object containing both gene expression and CRISPR guide capture matrices. A third assay summarizing the total gene-level counts of all four sgRNAs for each target gene was also created, followed by pooling of 5 samples using the ‘merge’ function. Cells were initially quality filtered based on the percentage of mitochondrial reads <10% (to remove dead cells) and the number of detected RNA features <7,500 and UMI feature <50,000 (to remove doublets for downstream gene expression analysis). Cells detected with sgRNAs targeting two or more genes were then removed to avoid interference from multi-sgRNA-transduced cells. A total of 19,032 P14 cells passed quality filtering and were used for downstream analysis. For the scCRISPR screening of IL-2 signalling regulators along with additional perturbations (Extended Data Fig. 1m), similar preprocessing was conducted as above. In brief, cells were first filtered based on the percentage of mitochondrial reads <10% (to remove dead cells) and the number of detected RNA features <6,000 and UMI feature <40,000 (to remove doublets for downstream gene expression analysis). Cells detected with sgRNAs targeting two or more genes were then removed to avoid interference from multi-sgRNA-transduced cells. A total of 2,825 P14 cells containing sgRNAs targeting IL-2 signalling genes (Jak3, Stat5a, Stat5b, Socs1 and Socs3) and sgNTC passed quality filtering and were used for downstream analysis. To evaluate the enrichment or depletion of each perturbation relative to sgNTC (Extended Data Fig. 1c), cells expressing sgRNAs targeting the same gene (3 sgRNAs per gene) were pooled. We calculated the log2FC in cell number by comparing the number of cells expressing each perturbation with the number of sgNTC-expressing cells, followed by normalization using the ratio of the number of sgRNAs targeting each perturbation to the number of sgNTC sgRNAs in the sgRNA library. To calculate replicate-level statistics for the relative enrichment and depletion of total P14 cells in Supplementary Table 7 (specifically, five 10X Genomics reactions (technical replicates) for the scCRISPR screen in Fig. 1a and eight technical replicates for the scCRISPR screen in Extended Data Fig. 1m), the average gene-level log2FC was calculated as the mean of gene-level log2FCs across all technical replicates. To assess the reproducibility of gene-level effects across technical replicates, two-sided, one-sample t-tests were performed on the replicate-specific, gene-level log2FC values against a null hypothesis of zero mean effect. Resulting P values were adjusted for multiple hypothesis testing using the Benjamini–Hochberg procedure to control the false discovery rate (FDR).

For cell clustering, the FindClusters function of the Seurat R package (v5.1.0) was used to identify the clusters in P14 cells in an unbiased manner. To determine the molecular determinants for P14 cell developmental trajectory, clusters were annotated as four cellular states (Texprog, Texint, TexKLR and Texterm) based on expression of indicated markers: Tcf7+Slamf6+ (Texprog), Cx3cr1+Mki67+Klrg1low (Texint), Cx3cr1+Klrg1hiKlre1hiKlrc1hiKlrd1hi (TexKLR) and Cx3cr1–Cd101+ (Texterm). Dot plots showing the relative average expression (after scaled normalization) of marker genes or effector molecules and cytokines in different clusters were visualized using the DotPlot function in the Seurat R package. Pseudotime trajectory analysis was performed (using default parameters in the Monocle3 R package64 (v1.3.7)) on the four Tex states with the Texprog state set as the starting point. Activity scores of gene signatures (such as the Texprog, Texint, TexKLR and Texterm signatures in Extended Data Fig. 1d curated from literature13) were calculated using AddModuleScore function of the Seurat package for the four cellular states and visualized by violin plots. To visualize the distribution of cells with a specific perturbation (at the gene level) on the UMAP, contour density plots were generated using the ggplot2 (v3.5.1) R package.

Network analysis

For network analysis, to mitigate the potential for observed phenotypes being driven by an outlier single sgRNA (which can be contributed by low cell recovery and/or sparse nature of scRNA-seq datasets), sgRNAs recovered in fewer than ten cells were excluded, similar as described31,82. Perturbations for which two sgRNAs failed to meet this minimum recovery threshold were excluded from downstream gene program analyses, resulting in the exclusion of a total of six genes (Batf, Ezh2, Nat10, Prmt1, Ssrp1 and Trim28). Along with 1,092 cells expressing sgNTC controls (representing 30 individual sgRNAs), we recovered an average of 189 cells per gene and 65 cells per sgRNA for gene-specific perturbations (Supplementary Table 6). log2FC (perturbation versus sgNTC) values were used to quantify the regulatory effect of each perturbation on target genes. The following bioinformatic analytical steps were applied to define regulomes associated with P14 cell differentiation. Step 1, similar to our previous publication31, our initial computational analysis calculated the individual gene regulatory effect of a specific genetic perturbation on target genes. Specifically, differential gene expression analysis was performed using the FindMarkers function in Seurat R package58, by comparing each perturbation to the sgNTC control. log2FC (perturbation versus sgNTC) values were used to quantify the regulatory effects of each perturbation on target genes. Step 2, to define co-regulated gene programs associated with Tex cell differentiation, differential expression analysis was performed by comparing each of the four Tex states with all other states combined. Differentially expressed genes (|log2FC (each state versus the other 3 states)| > 0.5) were combined, and redundant genes across states were removed. A gene × perturbation matrix (279 × 94, with log2FC of perturbation versus sgNTC values) was then constructed to generate a perturbation map (Fig. 1c, top left). Step 3, co-regulated gene programs (of the aforementioned 279 genes) were identified by Spearman correlation hierarchical clustering, with four major programs annotated, namely stemness (G1), proliferation (G2), effector function (G3) and exhaustion (G4) (Fig. 1c, bottom left), based on enrichment of pathways (Extended Data Fig. 1h). Meanwhile, co-functional modules were defined by Spearman correlation hierarchical clustering, resulting in nine modules labelled as M1–M9 (Fig. 1c, top right).

Step 4, following these initial steps to define gene regulatory effects, co-regulated gene programs, and co-functional modules, we then computed the average gene regulatory effect of a specific perturbation on a given gene program, defined as the average log2FC across all genes within that co-regulated gene program. As a final step, the average gene regulatory effect of a co-functional module on a given gene program was calculated as the mean of the gene regulatory effects across all genetic perturbations within the co-functional module (Fig. 1e and Extended Data Fig. 1i). The strength of regulation between perturbation modules and gene programs was visualized using the ggalluvial R package (v0.12.5), where the line width represents regulatory strength, colour (red versus blue) indicates positive or negative effects, and module height reflects the overall magnitude of regulation. The regulatory effect of perturbations on Tox expression was visualized by Cytoscape software (v3.10.3).

Gene-level perturbation ranking analysis

For gene-level perturbation ranking between Tex states (for example, Fig. 1f,g), cells expressing sgRNAs targeting the same gene (3 sgRNAs per gene) were pooled. For each gene perturbation, an enrichment score was calculated as the ratio of cells in a given Tex state relative to all other Tex states. To account for differences in the baseline abundance of individual Tex states, the enrichment score was normalized by the corresponding global cell ratio of that Tex state relative to all other Tex states across the entire dataset, and is reported as a normalized log2FC. To calculate replicate-level statistics for enrichment or depletion of Tex states (Supplementary Table 7), the average gene-level log2FC was calculated as the mean of gene-level log2FCs across all technical replicates. To assess the reproducibility of gene-level effects across technical replicates, the P values and FDR were subsequently calculated across the technical replicates as described above. GSEA was performed on the scCRISPR dataset by comparing sgZmynd8-expressing P14 cells with sgNTC-expressing P14 cells, using STAT5CA Up and Down gene signatures. The code for analysis of scCRISPR data in the relevant figure panels has been deposited to Zenodo (https://doi.org/10.5281/zenodo.21924005 (ref. 56)).

Library preparation for bulk CRISPR screening

Genomic DNA was extracted by using the DNeasy Blood & Tissue Kits (69506, QIAGEN). Primary PCR was performed by using the KOD Hot Start DNA Polymerase (71086, Millipore) and the following pair of Nextera next-generation sequencing (NGS) primers: (Nextera NGS forward (-F): TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGttgtggaaaggacgaaacaccg; Nextera NGS reverse (-R): GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGccactttttcaagttgataacgg). Primary PCR products were purified using the AMPure XP beads (A63881, Beckman). A second PCR reaction was performed to attach Illumina adapters and indexes to barcode each sample. Hi-Seq 50-bp single-end sequencing (Illumina) was performed for library sequencing.

Data analysis for bulk CRISPR screening

FASTQ read files obtained after sequencing were demultiplexed using Hi-Seq analysis software (Illumina) and processed using mageck (v0.5.9.4) software83. Raw count tables were generated using the mageck count command by matching the sgRNA sequence of the aforementioned. Read counts for sgRNAs were normalized against median read counts across all samples for each screening. For each gene or sgRNA in the sgRNA library, the log2FC for enrichment or depletion was calculated using the mageck test command, with the gene-lfc-method parameter as the mean and control-sgrna parameter using the list of sgNTCs. The sgRNA count table and analysis of bulk CRISPR screening data have been deposited to Zenodo (https://doi.org/10.5281/zenodo.21909366 (ref. 81)). The code for analysis of bulk CRISPR data in the relevant figure panels has been deposited to Zenodo (https://doi.org/10.5281/zenodo.21924005 (ref. 56)).

Statistical analysis for biological experiments

For biological experiment (non-omics) analyses, data were analysed by Prism software (v11 for tumour growth curve experiments and v9 for other experiments; GraphPad) using two-tailed unpaired Student’s t-tests, one-way analysis of variance (ANOVA) or two-way ANOVA, as indicated in the figure legends. A two-tailed Student’s t-test was used to compare the two groups. For multiple comparisons, a one-way or two-way ANOVA with Tukey’s or Sidak’s multiple-comparisons test was applied. For comparing mouse tumour growth curves, two-way ANOVA with Geisser–Greenhouse correction was applied. The log-rank (Mantel–Cox) test was performed to compare mouse survival curves. Two-tailed Wilcoxon rank-sum tests were applied for activity score (without Bonferroni correction adjustment) or expression (with Bonferroni correction adjustment) analysis of scRNA-seq data. P < 0.05 was considered statistically significant with P value annotations shown as *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001. In all bar plots, data are presented as the mean ± s.e.m. The exact P values are shown in the source data files that accompany this manuscript.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

The authors declare that the data supporting the findings of this study are available within the manuscript and its Supplementary Information. All bulk CRISPR and scCRISPR screening, ATAC–seq, CUT&RUN, scRNA-seq and single-cell multiomics data described in the manuscript have been deposited into Gene Expression Omnibus (GEO) Superseries access number GSE342764 and Zenodo (https://doi.org/10.5281/zenodo.21909366 (ref. 81)). Public scRNA-seq, bulk RNA-seq or scATAC–seq datasets are available through GSE122712, GSE164177, GSE89307, GSE157829, GSE123139, GSE120575, GSE123813, GSE205506, GSE206732, GSE252650, GSE149876, GSE123235 and GSE230363, Zenodo (https://zenodo.org/records/10604293 (ref. 84)). Hallmark, C2, C5 and C7 collections were from the MSigDB (https://www.broadinstitute.org/gsea/msigdb/). The TRANSFAC 2019 Vertebrata database was commercially available at GeneXplain GmbH (https://genexplain.com/transfac-database/). Source data are provided with this paper.

Code availability

The original code for bioinformatics analyses has been deposited at Zenodo (https://doi.org/10.5281/zenodo.21924005 (ref. 56)).

References

  1. Sun, Q. & Dong, C. Regulators of CD8+ T cell exhaustion. Nat. Rev. Immunol. 26, 129–151 (2025).

    Article  PubMed  Google Scholar 

  2. Shouse, A. N., LaPorte, K. M. & Malek, T. R. Interleukin-2 signaling in the regulation of T cell biology in autoimmunity and cancer. Immunity 57, 414–428 (2024).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  3. Giles, J. R., Globig, A. M., Kaech, S. M. & Wherry, E. J. CD8+ T cells in the cancer-immunity cycle. Immunity 56, 2231–2253 (2023).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  4. Khan, O. et al. TOX transcriptionally and epigenetically programs CD8+ T cell exhaustion. Nature 571, 211–218 (2019).

    Article  ADS  CAS  PubMed  PubMed Central  Google Scholar 

  5. Scott, A. C. et al. TOX is a critical regulator of tumour-specific T cell differentiation. Nature 571, 270–274 (2019).

    Article  ADS  CAS  PubMed  PubMed Central  Google Scholar 

  6. Alfei, F. et al. TOX reinforces the phenotype and longevity of exhausted T cells in chronic viral infection. Nature 571, 265–269 (2019).

    Article  ADS  CAS  PubMed  Google Scholar 

  7. Yao, C. et al. Single-cell RNA-seq reveals TOX as a key regulator of CD8+ T cell persistence in chronic infection. Nat. Immunol. 20, 890–901 (2019).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  8. Seo, H. et al. TOX and TOX2 transcription factors cooperate with NR4A transcription factors to impose CD8+ T cell exhaustion. Proc. Natl Acad. Sci. USA 116, 12410–12415 (2019).

    Article  ADS  CAS  PubMed  PubMed Central  Google Scholar 

  9. Hudson, W. H. et al. Proliferating transitory T cells with an effector-like transcriptional signature emerge from PD-1+ stem-like CD8+ T cells during chronic infection. Immunity 51, 1043–1058.e1044 (2019).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  10. Zander, R. et al. CD4+ T cell help is required for the formation of a cytolytic CD8+ T cell subset that protects against chronic infection and cancer. Immunity 51, 1028–1042.e4 (2019).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  11. Beltra, J. C. et al. Developmental relationships of four exhausted CD8+ T cell subsets reveals underlying transcriptional and epigenetic landscape control mechanisms. Immunity 52, 825–841.e8 (2020).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  12. Giles, J. R. et al. Shared and distinct biological circuits in effector, memory and exhausted CD8+ T cells revealed by temporal single-cell transcriptomics and epigenetics. Nat. Immunol. 23, 1600–1613 (2022).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  13. Daniel, B. et al. Divergent clonal differentiation trajectories of T cell exhaustion. Nat. Immunol. 23, 1614–1627 (2022).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  14. Shi, H., Doench, J. G. & Chi, H. CRISPR screens for functional interrogation of immunity. Nat. Rev. Immunol. 23, 363–380 (2023).

    Article  CAS  PubMed  Google Scholar 

  15. Miller, B. C. et al. Subsets of exhausted CD8+ T cells differentially mediate tumor control and respond to checkpoint blockade. Nat. Immunol. 20, 326–336 (2019).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  16. Baxter, A. E. et al. The SWI/SNF chromatin remodeling complexes BAF and PBAF differentially regulate epigenetic transitions in exhausted CD8+ T cells. Immunity 56, 1320–1340.e10 (2023).

    Article  CAS  PubMed  Google Scholar 

  17. Chen, Y. et al. BATF regulates progenitor to cytolytic effector CD8+ T cell transition during chronic viral infection. Nat. Immunol. 22, 996–1007 (2021).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  18. Seo, H. et al. BATF and IRF4 cooperate to counter exhaustion in tumor-infiltrating CAR T cells. Nat. Immunol. 22, 983–995 (2021).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  19. Wei, J. et al. Targeting REGNASE-1 programs long-lived effector T cells for cancer therapy. Nature 576, 471–476 (2019).

    Article  ADS  CAS  PubMed  PubMed Central  Google Scholar 

  20. Kumar, S. et al. CARM1 inhibition enables immunotherapy of resistant tumors by dual action on tumor cells and T cells. Cancer Discov. 11, 2050–2071 (2021).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  21. Beltra, J. C. et al. Stat5 opposes the transcription factor Tox and rewires exhausted CD8+ T cells toward durable effector-like states during chronic antigen exposure. Immunity 56, 2699–2718.e11 (2023).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  22. Huang, H. et al. In vivo CRISPR screening reveals nutrient signaling processes underpinning CD8+ T cell fate decisions. Cell 184, 1245–1261.e21 (2021).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  23. West, E. E. et al. PD-L1 blockade synergizes with IL-2 therapy in reinvigorating exhausted T cells. J. Clin. Invest. 123, 2604–2615 (2013).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  24. Hashimoto, M. et al. PD-1 combination therapy with IL-2 modifies CD8+ T cell exhaustion program. Nature 610, 173–181 (2022).

    Article  ADS  CAS  PubMed  PubMed Central  Google Scholar 

  25. Belk, J. A. et al. Genome-wide CRISPR screens of T cell exhaustion identify chromatin remodeling factors that limit T cell persistence. Cancer Cell 40, 768–786.e7 (2022).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  26. Chen, Y., Tsai, Y. H. & Tseng, S. H. Regulation of ZMYND8 to treat cancer. Molecules 26, 1083 (2021).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  27. Creyghton, M. P. et al. Histone H3K27ac separates active from poised enhancers and predicts developmental state. Proc. Natl Acad. Sci. USA 107, 21931–21936 (2010).

    Article  ADS  CAS  PubMed  PubMed Central  Google Scholar 

  28. Simeonov, D. R. et al. Discovery of stimulation-responsive immune enhancers with CRISPR activation. Nature 549, 111–115 (2017).

    Article  ADS  CAS  PubMed  PubMed Central  Google Scholar 

  29. Cao, Z. et al. ZMYND8-regulated IRF8 transcription axis is an acute myeloid leukemia dependency. Mol. Cell 81, 3604–3622.e10 (2021).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  30. Wang, S. et al. An atlas of immune cell exhaustion in HIV-infected individuals revealed by single-cell transcriptomics. Emerg. Microbes Infect. 9, 2333–2347 (2020).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  31. Zhou, P. et al. Single-cell CRISPR screens in vivo map T cell fate regulomes in cancer. Nature 624, 154–163 (2023).

    Article  ADS  CAS  PubMed  PubMed Central  Google Scholar 

  32. Burger, M. L. et al. Antigen dominance hierarchies shape TCF1+ progenitor CD8 T cell phenotypes in tumors. Cell 184, 4996–5014.e26 (2021).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  33. Philip, M. et al. Chromatin states define tumour-specific T cell dysfunction and reprogramming. Nature 545, 452–456 (2017).

    Article  ADS  CAS  PubMed  PubMed Central  Google Scholar 

  34. Li, H. et al. Dysfunctional CD8 T cells form a proliferative, dynamically regulated compartment within human melanoma. Cell 176, 775–789.e18 (2019).

    Article  CAS  PubMed  Google Scholar 

  35. Zhao, M. et al. Rapid in vitro generation of bona fide exhausted CD8+ T cells is accompanied by Tcf7 promotor methylation. PLoS Pathog. 16, e1008555 (2020).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  36. Zheng, W. et al. Regnase-1 suppresses TCF-1+ precursor exhausted T-cell formation to limit CAR-T-cell responses against ALL. Blood 138, 122–135 (2021).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  37. Beck, J. D. et al. Long-lasting mRNA-encoded interleukin-2 restores CD8+ T cell neoantigen immunity in MHC class I-deficient cancers. Cancer Cell 42, 568–582.e11 (2024).

    Article  CAS  PubMed  Google Scholar 

  38. Moynihan, K. D. et al. IL2 targeted to CD8+ T cells promotes robust effector T-cell responses and potent antitumor immunity. Cancer Discov. 14, 1206–1225 (2024).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  39. Yost, K. E. et al. Clonal replacement of tumor-specific T cells following PD-1 blockade. Nat. Med. 25, 1251–1259 (2019).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  40. Li, J. et al. Remodeling of the immune and stromal cell compartment by PD-1 blockade in mismatch repair-deficient colorectal cancer. Cancer Cell 41, 1152–1169.e7 (2023).

    Article  PubMed  Google Scholar 

  41. Sade-Feldman, M. et al. Defining T cell states associated with response to checkpoint immunotherapy in melanoma. Cell 175, 998–1013.e20 (2018).

    Article  ADS  CAS  PubMed  PubMed Central  Google Scholar 

  42. Pauken, K. E. et al. Epigenetic stability of exhausted T cells limits durability of reinvigoration by PD-1 blockade. Science 354, 1160–1165 (2016).

    Article  ADS  CAS  PubMed  PubMed Central  Google Scholar 

  43. Shen, H. et al. Suppression of enhancer overactivation by a RACK7–histone demethylase complex. Cell 165, 331–342 (2016).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  44. Villarino, A. V. et al. A central role for STAT5 in the transcriptional programing of T helper cell metabolism. Sci. Immunol. 7, eabl9467 (2022).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  45. Pircher, H., Burki, K., Lang, R., Hengartner, H. & Zinkernagel, R. M. Tolerance induction in double specific T-cell receptor transgenic mice varies with antigen. Nature 342, 559–561 (1989).

    Article  ADS  CAS  PubMed  Google Scholar 

  46. Overwijk, W. W. et al. Tumor regression and autoimmunity after reversal of a functionally tolerant state of self-reactive CD8+ T cells. J. Exp. Med. 198, 569–580 (2003).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  47. Platt, R. J. et al. CRISPR-Cas9 knockin mice for genome editing and cancer modeling. Cell 159, 440–455 (2014).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  48. McCausland, M. M. & Crotty, S. Quantitative PCR technique for detecting lymphocytic choriomeningitis virus in vivo. J. Virol. Methods 147, 167–176 (2008).

    Article  CAS  PubMed  Google Scholar 

  49. Panday, A., Elango, R., Willis, N. A. & Scully, R. A modified CUT&RUN-seq technique for qPCR analysis of chromatin-protein interactions. STAR Protoc. 3, 101529 (2022).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  50. Ewels, P. A. et al. The nf-core framework for community-curated bioinformatics pipelines. Nat. Biotechnol. 38, 276–278 (2020).

    Article  CAS  PubMed  Google Scholar 

  51. Meers, M. P., Tenenbaum, D. & Henikoff, S. Peak calling by sparse enrichment analysis for CUT&RUN chromatin profiling. Epigenetics Chromatin 12, 42 (2019).

    Article  PubMed  PubMed Central  Google Scholar 

  52. Zhang, Y. et al. Model-based analysis of ChIP–seq (MACS). Genome Biol. 9, R137 (2008).

    Article  PubMed  PubMed Central  Google Scholar 

  53. Yu, G., Wang, L. G. & He, Q. Y. ChIPseeker: an R/Bioconductor package for ChIP peak annotation, comparison and visualization. Bioinformatics 31, 2382–2383 (2015).

    Article  CAS  PubMed  Google Scholar 

  54. Zheng, R. et al. Cistrome Data Browser: expanded datasets and new tools for gene regulatory analysis. Nucleic Acids Res. 47, D729–D735 (2019).

    Article  ADS  CAS  PubMed  PubMed Central  Google Scholar 

  55. Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 550 (2014).

    Article  PubMed  PubMed Central  Google Scholar 

  56. Shi, H. & Chi, H. Zmynd8 manuscript code [Computer software]. Zenodo https://doi.org/10.5281/zenodo.21924005 (2026).

  57. Zheng, G. X. et al. Massively parallel digital transcriptional profiling of single cells. Nat. Commun. 8, 14049 (2017).

    Article  ADS  CAS  PubMed  PubMed Central  Google Scholar 

  58. Hao, Y. et al. Dictionary learning for integrative, multimodal and scalable single-cell analysis. Nat. Biotechnol. 42, 293–304 (2024).

    Article  ADS  CAS  PubMed  Google Scholar 

  59. Im, S. J. et al. Defining CD8+ T cells that provide the proliferative burst after PD-1 therapy. Nature 537, 417–421 (2016).

    Article  ADS  CAS  PubMed  PubMed Central  Google Scholar 

  60. Joshi, N. S. et al. Inflammation directs memory precursor and short-lived effector CD8+ T cell fates via the graded expression of T-bet transcription factor. Immunity 27, 281–295 (2007).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  61. Tirosh, I. et al. Dissecting the multicellular ecosystem of metastatic melanoma by single-cell RNA-seq. Science 352, 189–196 (2016).

    Article  ADS  CAS  PubMed  PubMed Central  Google Scholar 

  62. Milner, J. J. et al. Runx3 programs CD8+ T cell residency in non-lymphoid tissues and tumours. Nature 552, 253–257 (2017).

    Article  ADS  CAS  PubMed  PubMed Central  Google Scholar 

  63. Qin, Q. et al. Lisa: inferring transcriptional regulators through integrative modeling of public chromatin accessibility and ChIP–seq data. Genome Biol. 21, 32 (2020).

    Article  PubMed  PubMed Central  Google Scholar 

  64. Trapnell, C. et al. The dynamics and regulators of cell fate decisions are revealed by pseudotemporal ordering of single cells. Nat. Biotechnol. 32, 381–386 (2014).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  65. Subramanian, A. et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl Acad. Sci. USA 102, 15545–15550 (2005).

    Article  ADS  CAS  PubMed  PubMed Central  Google Scholar 

  66. Fagerberg, E. et al. KLF2 maintains lineage fidelity and suppresses CD8 T cell exhaustion during acute LCMV infection. Science 387, eadn2337 (2025).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  67. Buenrostro, J. D., Giresi, P. G., Zaba, L. C., Chang, H. Y. & Greenleaf, W. J. Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position. Nat. Methods 10, 1213–1218 (2013).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  68. Heinz, S. et al. Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities. Mol. Cell 38, 576–589 (2010).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  69. Liberzon, A. et al. The Molecular Signatures Database (MSigDB) hallmark gene set collection. Cell Syst. 1, 417–425 (2015).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  70. Grant, C. E., Bailey, T. L. & Noble, W. S. FIMO: scanning for occurrences of a given motif. Bioinformatics 27, 1017–1018 (2011).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  71. Li, Z. et al. Identification of transcription factor binding sites using ATAC-seq. Genome Biol. 20, 45 (2019).

    Article  PubMed  PubMed Central  Google Scholar 

  72. Guo, A. et al. cBAF complex components and MYC cooperate early in CD8+ T cell fate. Nature 607, 135–141 (2022).

    Article  ADS  CAS  PubMed  PubMed Central  Google Scholar 

  73. Yao, C. et al. BACH2 enforces the transcriptional and epigenetic programs of stem-like CD8+ T cells. Nat. Immunol. 22, 370–380 (2021).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  74. Tsui, C. et al. MYB orchestrates T cell exhaustion and response to checkpoint inhibition. Nature 609, 354–360 (2022).

    Article  ADS  CAS  PubMed  PubMed Central  Google Scholar 

  75. Shin, H. et al. A role for the transcriptional repressor Blimp-1 in CD8+ T cell exhaustion during chronic viral infection. Immunity 31, 309–320 (2009).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  76. Kao, C. et al. Transcription factor T-bet represses expression of the inhibitory receptor PD-1 and sustains virus-specific CD8+ T cell responses during chronic infection. Nat. Immunol. 12, 663–671 (2011).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  77. Utzschneider, D. T. et al. T cell factor 1-expressing memory-like CD8+ T cells sustain the immune response to chronic viral infections. Immunity 45, 415–427 (2016).

    Article  CAS  PubMed  Google Scholar 

  78. Chen, Z. et al. TCF-1-centered transcriptional network drives an effector versus exhausted CD8 T cell-fate decision. Immunity 51, 840–855.e5 (2019).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  79. Dominguez, C. X. et al. The transcription factors ZEB2 and T-bet cooperate to program cytotoxic T cell terminal differentiation in response to LCMV viral infection. J. Exp. Med. 212, 2041–2056 (2015).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  80. Omilusik, K. D. et al. Transcriptional repressor ZEB2 promotes terminal differentiation of CD8+ effector and memory T cell populations during infection. J. Exp. Med. 212, 2027–2039 (2015).

    Article  PubMed  PubMed Central  Google Scholar 

  81. Shi, H. & Chi, H. Bulk CRISPR and IL2 signalling scCRISPR screen [Dataset]. Zenodo https://doi.org/10.5281/zenodo.21909366 (2026).

  82. Song, B. et al. Decoding heterogeneous single-cell perturbation responses. Nat. Cell Biol. 27, 493–504 (2025).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  83. Li, W. et al. MAGeCK enables robust identification of essential genes from genome-scale CRISPR/Cas9 knockout screens. Genome Biol. 15, 554 (2014).

    Article  PubMed  PubMed Central  Google Scholar 

  84. Streuber, M. An mRNA-encoded, long-lasting Interleukin-2 restores CD8+ T cell neoantigen immunity in MHC class I-deficient cancers [Data set]. Zenodo https://doi.org/10.5281/zenodo.10604293 (2024).

Download references

Acknowledgements

The authors acknowledge J. Raynor, J. Saravia and Z. You for scientific discussions; M. Hendren, R. Walton and S. Rankin for animal colony management and technical support; the staff at the St. Jude Immunology flow cytometry core facility for cell sorting; the staff at the Hartwell Center for sequencing analyses; the members of Center for Advanced Genome Engineering for CRISPR library design, construction and deletional analysis. Parts of the figures were drawn using BioRender.

Funding

This work was supported by ALSAC and National Institutes of Health (NIH) grants CA253188, AI105887, AI131703, AI140761, AI150241 and AI150514 (to H.C.). The Hartwell Center and Center for Advanced Genome Engineering are funded by the Cancer Center Support Grant (P30 CA021765). The content is solely the responsibility of the authors and does not necessarily represent the official views of the NIH.

Author information

Author notes

  1. These authors contributed equally: Yan Wang, Hao Shi

Authors and Affiliations

  1. Department of Immunology, St. Jude Children’s Research Hospital, Memphis, TN, USA

    Yan Wang, Hao Shi, Nicole M. Chapman, Anil KC, Renqiang Sun, Hao Song, Xiaoxi Meng, Xiang Sun & Hongbo Chi

Authors

  1. Yan Wang
  2. Hao Shi
  3. Nicole M. Chapman
  4. Anil KC
  5. Renqiang Sun
  6. Hao Song
  7. Xiaoxi Meng
  8. Xiang Sun
  9. Hongbo Chi

Contributions

Y.W. conceived, designed and performed cellular and molecular experiments, analysed data and wrote the manuscript. H. Shi performed bioinformatic analyses, wrote the manuscript and helped to conceive and design cellular and molecular experiments. N.M.C. co-wrote the manuscript. A.K. prepared scRNA-seq and ATAC–seq libraries. R.S. generated ZMYND8 truncation constructs and performed co-immunoprecipitation experiments. H. Song performed part of the immunoblot analysis. X.M. performed bioinformatic analysis. X.S. helped to perform scCRISPR screening library preparation (first two steps). H.C. helped to conceive and design experiments, co-wrote the manuscript and provided overall direction.

Corresponding author

Correspondence to Hongbo Chi.

Ethics declarations

Competing interests

H.C. consults for Kumquat Biosciences Inc. and TCura Bioscience and is a co-inventor on patents/patent applications in the field of immunotherapy. The other authors declare no competing interests.

Peer review

Peer review information

Nature thanks David Barbie, Tuoqi Wu, Keji Zhao and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. Peer reviewer reports are available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Extended data figures and tables

Extended Data Fig. 1 (related to Fig. 1). In vivo CRISPR screens for epigenetic regulators identify a selective role of ZMYND8 in CD8+ T cell exhaustion.

a, Bioinformatic approach that nominated 91 epigenetic genes in the scCRISPR library. Nine literature-curated transcription factors were also included (see Methods). DE, differential expression of genes. DA, differential accessibility of open chromatin regions. b, Total sgRNA representation in the library compared with the recovered sgRNA number in P14 cells from the scCRISPR screen at day 28 p.i. (left 2 columns); abundance of total sgNTCs in the library and recovered sgNTCs in P14 cells (right 2 columns). c, Rank plot depicting top enriched (red) and depleted (blue) genes ranked by the relative ratio (indicated by log2FC) of cells with each gene-level perturbation compared with sgNTC in scCRISPR screening. d, Violin plots showing the activity scores of Texprog, Texint, TexKLR and Texterm signatures (curated from GSE188666) in the annotated Texprog, Texint, TexKLR and Texterm cells in scCRISPR screening (see Fig. 1b) (n = 2,845 for Texprog, 5,289 for Texint, 6,604 for TexKLR, and 4,294 for Texterm cells). The boxes represent 25% to 75% interquartile range (IQR), and whiskers depict the minimum (25% quantile – 1.5* IQR) to maximum (75% quantile + 1.5* IQR) values. e, f, Dot plots showing the relative expression of Texprog, Texint, TexKLR and Texterm cell-associated genes (e) and Ifng, Tnf, Gzma, Gzmb and Prf1 (f) in Texprog, Texint, TexKLR and Texterm states among P14 cells from LCMV Cl13-infected mice at day 28 p.i. (from scCRISPR screening dataset). g, sgNTC-transduced Cas9+ P14 cells (Ametrine+) were transferred into Cas9+ recipient mice, followed by LCMV Cl13 infection. Quantification of gMFIs of IFNγ, TNF, GZMA, GZMB and perforin among the Texprog (Ly108+CX3CR1–), Texint (CX3CR1+KLRG1–), TexKLR (CX3CR1+KLRG1+) and Texterm (Ly108–CX3CR1–) subpopulations of sgNTC-expressing P14 cells at day 28 p.i. (n = 6 per group). h, Top enriched pathways (two-tailed Fisher’s exact test) in the four co-regulated gene programs (G1–G4) shown in Fig. 1c. i, Regulatory connections between the nine perturbation modules and four gene programs. Red and blue lines indicate positive and negative regulatory effects, respectively. Line width shows regulation strength (see Methods). The height of each perturbation module represents the combined regulatory potential across the four downstream gene programs. j, Perturbations (colour-coded based on their classification into perturbation modules) that regulate Tox expression (|log2FC (perturbation versus sgNTC)| > 0.35) in scCRISPR screening. Red and blue lines indicate positive and negative regulatory effects, respectively. k, l, sgNTC-transduced Cas9+ P14 cells (Ametrine+) were transferred into Cas9+ recipient mice, followed by LCMV Cl13 infection. Ametrine+ P14 cells were sorted or analysed at days 7, 14, 21 and 28 p.i. (n = 6 per group). Real-time PCR analysis of relative Il2ra (left) and Il2rb (right) mRNA levels (normalized to expression at day 7 p.i.) at the indicated days p.i. (k). Quantification of the frequencies of CD25+ cells (left) and gMFIs of CD122 (right) on donor-derived splenic P14 cells at the indicated timepoints (l). m, n, Percentages of indicated cell states among cells with indicated perturbations in scCRISPR screening of IL-2 signalling regulators (similar to the method applied in Fig. 1a; see Methods) (m, left). Recovered P14 cell abundance for sgNTC, sgJak3, sgStat5a, sgStat5b, sgSocs1 and sgSocs3 in the Texprog, Texint, TexKLR, and Texterm states, based on scCRISPR screening (m, right). Rank plot depicting the relative ratio (log2FC) of cell number with each gene-level perturbation (aggregated from 3 sgRNAs targeting the same gene) versus that of sgNTC (on average) in scCRISPR screening (n). o, Top positive (blue bars) and negative (red bars) regulators of Texprog compared with other Tex states based on the perturbation effects in scCRISPR screening. p, Top positive (blue bars) and negative (red bars) regulators of Texterm compared with other Tex states based on the perturbation effects in scCRISPR screening. q, Top positive (blue bars) and negative (red bars) regulators of Texint compared with Texterm states based on the perturbation effects in scCRISPR screening. r, Volcano plot showing the significantly depleted (blue) and enriched (red) gene perturbations in effector-like (Ly108–CX3CR1+) compared with Texterm (Ly108–CX3CR1–) cells in bulk CRISPR screening. s, Volcano plot showing the significantly depleted (blue) and enriched (red) gene perturbations in Texterm (Ly108–CX3CR1–) compared with total P14 cells in bulk CRISPR screening. t, Violin plots showing the activity scores of STAT5CA Up signature in Texprog, Texint, TexKLR and Texterm states from scCRISPR screening dataset (n = 2,845 for Texprog, 5,289 for Texint, 6,604 for TexKLR and 4,294 for Texterm cells). The boxes represent 25% to 75% interquartile range (IQR), and whiskers depict the minimum (25% quantile – 1.5* IQR) to maximum (75% quantile + 1.5* IQR) values. u, Quantification of the relative proportions of Texprog, Texint, TexKLR and Texterm states among sgNTC and sgZmynd8-expressing P14 cells from scCRISPR screening dataset. v, Distributions of sgZmynd8-expressing P14 cells (left) and activity score of STAT5CA Up signature (right) on UMAPs from scCRISPR screening. w, Contour density plots on UMAPs showing distributions of sgNTC and the three individual Zmynd8-targeting sgRNAs (indicated as g1, g2 and g3) in Tex states as profiled by scCRISPR screening. Corresponding numbers of recovered cells for each sgRNA are shown. The sgNTC contour plot is also presented in Extended Data Fig. 10b. x, Immunoblot analysis of ZMYND8 protein in sgNTC or indicated sgZmynd8-transduced Cas9+ P14 cells isolated from the spleen at day 7 p.i. β-actin (ACTB) was used as a loading control. Densitometric quantification of ZMYND8 is shown. For gel source data, see Supplementary Fig. 2. Data are representative of two (g, k and l) or one (x) independent experiments. NS, not significant; *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001; two-tailed Wilcoxon rank sum test (d and t) or one-way ANOVA (g, k and l). Data are presented as mean ± SEM (g, k and l).

Source data

Extended Data Fig. 2 (related to Fig. 2). ZMYND8 deficiency promotes effector-like state and restrains the conversion to Texterm state.

a, Experimental schematic of dual-colour transfer system. Cas9-expressing P14 cells transduced with sgNTC (Ametrine+) were mixed at a 1:1 ratio with cells transduced with sgZmynd8 (GFP+) and co-transferred to the same recipient Cas9+ mice, followed by LCMV Cl13 infection. scRNA-seq analysis of P14 cells was performed at day 21 p.i., and flow cytometry analysis of P14 cells was performed at day 21, 28 or 90 p.i. (as specified in the figure legends). Created in BioRender; Wang, Y. https://BioRender.com/3jr1r24 (2026). b, Dot plot showing the relative expression of Texprog, Texint, TexKLR and Texterm cell-associated genes (left), and UMAP plots showing the expression of Klrc1, Klrd1, Klre1, Klrg1 and Klrk1 genes (right) in P14 cells at day 21 p.i. from scRNA-seq profiling. The dashed lines depict the clusters containing the TexKLR state. c, GSEA enrichment plots show upregulation of the effector-like signature (left) and downregulation of Texprog (middle) and Texterm (right) signatures in sgZmynd8-expressing P14 cells compared with sgNTC-expressing P14 cells at day 21 p.i., based on GSEA of the scRNA-seq dataset. The Tex state signatures were curated from a public scRNA-seq profiling of P14 cells from LCMV Cl13-infected mice at day 30 p.i. (GSE129139; see Methods). d, Volcano plot showing differentially expressed (|log2FC|>0.4; bonferroni correction adjusted P < 0.05) genes in sgZmynd8-expressing compared with sgNTC-expressing P14 cells (from scRNA-seq profiling). e–l, Cas9-expressing P14 cells transduced with sgNTC or sgZmynd8 (GFP+) were mixed with sgNTC-transduced (‘spike’; Ametrine+) P14 cells at a 1:1 ratio and co-transferred into Cas9+ mice, followed by LCMV Cl13 infection (dual-colour transfer system) and analysis at day 21 (e, n = 8 per group; j, n = 7 per group), 28 (f, g, k, n = 7 per group) or 90 (h, i, l, n = 5 per group) p.i. Flow cytometry analysis (left) and quantification of relative frequency and number (right) of Texterm (TIM-3+CD101+) (e). Flow cytometry analysis (left) and quantification of relative frequencies (normalized to co-transferred ‘spike’ cells) and numbers of effector-like (Ly108–CX3CR1+; middle two panels) and Texterm (Ly108–CX3CR1–; right two panels) cells among donor-derived splenic P14 cells at days 28 (f) and 90 (h) p.i. Quantification of relative frequencies (normalized to co-transferred ‘spike’ cells; left) and numbers (right) of Texterm (TIM-3+CD101+) cells among donor-derived splenic P14 cells at days 28 (g) and 90 (i) p.i. Quantification of relative frequencies (normalized to co-transferred ‘spike’ cells; left) and numbers (right) of Texprog (Ly108+CX3CR1–) cells among donor-derived splenic P14 cells at days 21 (j), 28 (k) and 90 (l) p.i. m, n, Quantification of gMFI of Ki67 (m, n = 5 per group) and frequency of active caspase-3+ cells (n, n = 6 per group) among donor-derived splenic total P14 cells or their Texprog (Ly108+CX3CR1–), effector-like (Ly108–CX3CR1+) and Texterm (Ly108–CX3CR1–) subpopulations at day 21 p.i. (from dual-colour transfer system). o, Quantification of the number of donor-derived P14 cells in the spleen at day 21 p.i. (from dual-colour transfer system) (n = 5 per group). p, q, Cas9-expressing P14 cells transduced with sgNTC or the indicated Zmynd8-specific sgRNA (sgZmynd8.g1, sgZmynd8.g2, sgZmynd8.g3) (Ametrine+) were mixed at a 1:1 ratio with cells transduced with sgNTC (‘spike’; GFP+) and adoptively transferred to the same recipient Cas9+ mice, followed by LCMV Cl13 infection (dual-colour transfer system) and analysis at day 21 p.i. (n = 5 per group). Flow cytometry analysis (left) and quantification of relative frequencies (normalized to co-transferred ‘spike’ cells) and numbers of effector-like (Ly108–CX3CR1+; left two panels), Texprog (Ly108+CX3CR1–; middle two panels) and Texterm (Ly108–CX3CR1–; right two panels) cells among donor-derived splenic P14 cells (p). Flow cytometry analysis (left) and quantification of relative frequency (normalized to co-transferred ‘spike’ cells) and number (right) of Texterm (TIM-3+CD101+) cells among donor-derived P14 cells (q). r, Naïve P14 cells electroporated with sgNTC or sgZmynd8 and Cas9 RNPs were stimulated with plate-bound anti-CD3 (10 μg ml–1) and anti-CD28 (5 μg ml–1) antibodies for 24 h and then cultured with IL-2 (20 IU ml−1) for 3 days. Immunoblot analysis of ZMYND8 and ACTB protein expression in the indicated P14 cells. ACTB was used as a loading control. For gel source data, see Supplementary Fig. 2. s–u Naïve P14 cells electroporated with sgNTC or sgZmynd8 (CD45.2+) and Cas9 RNPs were mixed with sgNTC-expressing (‘spike’; CD45.1+CD45.2+) P14 cells at a 1:1 ratio, and co-transferred into CD45.1+ Cas9+ mice, followed by LCMV Cl13 infection one day later. P14 subpopulations were analysed at day 21 p.i. (n = 5 per group). Flow cytometry analysis (left) and quantification of relative frequencies (normalized to co-transferred ‘spike’ cells) and numbers (right) of effector-like (Ly108–CX3CR1+) and Texterm (Ly108–CX3CR1–) cells (s) and Texterm (TIM-3+CD101+) cells (t) among donor-derived splenic P14 cells. Quantification of frequency (normalized to co-transferred ‘spike’ cells; left) and number (right) of Texprog (Ly108+CX3CR1–) cells among donor-derived splenic P14 cells (u). Data are pooled from two (e–g, j and k) or are representative of three (h, i and l), two (m–q and s–u) or one (r) independent experiments. NS, not significant; *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001; two-tailed unpaired Student’s t-test (e–o and s–u) or one-way ANOVA (p, q). Data are presented as mean ± SEM (e–q and s–u).

Source data

Extended Data Fig. 3 (related to Fig. 2). ZMYND8 deficiency drives TexKLR differentiation.

a–c, Cas9-expressing P14 cells transduced with sgNTC or sgZmynd8 (Ametrine+) were mixed with sgNTC-transduced (‘spike’; GFP+) P14 cells at a 1:1 ratio and co-transferred into same recipient Cas9+ mice, followed by LCMV Cl13 infection. P14 subpopulations were analysed in spleen, mesenteric lymph nodes (mLN), peripheral lymph nodes (pLNs), liver and lung at day 21 p.i. (n = 6 per group). Flow cytometry analysis (left) and quantification (right) of relative frequencies (normalized to co-transferred ‘spike’ cells) and numbers of effector-like (Ly108–CX3CR1+) cells among donor-derived P14 cells in indicated tissues (a). Quantification of relative frequencies (normalized to co-transferred ‘spike’ cells) and numbers of Texterm (Ly108–CX3CR1–; left) and Texprog (Ly108+ CX3CR1−; right) cells among donor-derived P14 cells in indicated tissues (b). Quantification of relative frequencies (normalized to co-transferred ‘spike’ cells; left) and numbers (right) of Texterm (TIM-3+CD101+) among donor-derived P14 cells in indicated tissues (c). d, e, Cas9-expressing P14 cells transduced with sgNTC or sgZmynd8 (GFP+) were mixed with sgNTC-transduced (‘spike’; Ametrine+) P14 cells at a 1:1 ratio and co-transferred into Cas9+ mice, followed by LCMV Cl13 infection. At day 21 p.i., LCMV Cl13-infected recipient mice were injected intravascularly with anti-CD8α–PE antibody (2 μg per mouse), and mice were sacrificed 5 min after injection (n = 4 per group). Flow cytometry analysis of total splenic P14 cells, Texprog, effector-like and Texterm subpopulations labelled with intravascular anti-CD8α–PE (in red pulp, PE+) (d). Quantification of the frequencies of indicated total P14 cells or their Tex subpopulations in the red pulp (PE+) or white pulp (PE–) of the spleen (e). f, In the scRNA-seq profiling of P14 cells as described in Fig. 2a, Monocle3 pseudotime analysis was used to examine the predicted developmental trajectory (using the Texprog state as the starting point; left). The density plots show the distribution of sgNTC and sgZmynd8-expressing cells (middle) or Texprog, Texint, TexKLR and Texterm states (right) across pseudotime (x-axis). The middle density plot indicates pseudotime distinguished by genotypes (the region between the dashed lines marks the peak accumulation of ZMYND8-deficient P14 cells) and the right density plot indicates pseudotime distinguished by four Tex differentiation states. sgZmynd8-expressing cells predominantly accumulated in clusters corresponding to the TexKLR (and to a lesser extent the Texint) state, indicating a shift toward these differentiation states along the inferred trajectory. g, Cas9-expressing P14 cells transduced with sgNTC or sgZmynd8 (Ametrine+) were mixed with sgNTC-transduced (‘spike’; GFP+) P14 cells at a 1:1 ratio and transferred to Cas9+ mice, followed by LCMV Cl13 infection (dual-colour transfer system). Flow cytometry analysis (left) and quantification of frequency (right) of TexKLR (CD94 (Klrd1)+NKG2D (Klrk1)+) cells among donor-derived Texprog (Ly108+CX3CR1–), effector-like (Ly108–CX3CR1+) and Texterm (Ly108–CX3CR1–) cells in the spleen at day 21 p.i. (n = 5 per group). h, Cas9-expressing P14 cells transduced with sgNTC or the indicated Zmynd8-specific sgRNA (sgZmynd8.g1, sgZmynd8.g2, sgZmynd8.g3) (Ametrine+) were mixed at a 1:1 ratio with cells transduced with sgNTC (‘spike’; GFP+) and adoptively transferred to the same recipient Cas9+ mice, followed by LCMV Cl13 infection (dual-colour transfer system). Flow cytometry analysis (left) and quantification of relative frequency (normalized to co-transferred ‘spike’ cells) and number (right) of TexKLR (CD94+NKG2D+) cells among donor-derived splenic P14 cells at day 21 p.i. (n = 5 per group). i, Quantification of relative frequency (normalized to co-transferred ‘spike’ cells; left) and number (right) of TexKLR (CD94+NKG2D+) cells among donor-derived splenic P14 cells at day 90 p.i. (from dual-colour transfer system) (n = 5 per group). j, Quantification of relative frequencies (normalized to co-transferred ‘spike’ cells; left) and numbers (right) of TexKLR (CD94+NKG2D+) cells among donor-derived P14 cells in spleen, mLN, pLNs, liver and lung at day 21 p.i. (from dual-colour transfer system described in (g)) (n = 6 per group). k, l, Naïve P14 cells electroporated with sgNTC or sgZmynd8 (CD45.2+) and Cas9 RNPs were mixed with sgNTC-expressing (‘spike’; CD45.1+CD45.2+) P14 cells at a 1:1 ratio, and co-transferred into CD45.1+ Cas9+ mice, followed by infection with LCMV Cl13 one day later. P14 subpopulations were analysed at day 21 p.i. (n = 5 per group). Flow cytometry analysis (left) and quantification of relative frequency (normalized to co-transferred ‘spike’ cells; middle) and number (right) of TexKLR (CD94 (Klrd1)+NKG2D (Klrk1)+) cells in donor-derived splenic P14 cells (k). Quantification of frequency of TexKLR (CD94 (Klrd1)+NKG2D (Klrk1)+) cells among donor-derived Texprog (Ly108+CX3CR1–), effector-like (Ly108–CX3CR1+) and Texterm (Ly108–CX3CR1–) cells in the spleen (l). m, Flow cytometry analysis (left) and quantification of relative frequency (normalized to co-transferred ‘spike’ cells; right) of NK1.1+ cells among donor-derived splenic P14 cells at day 21 p.i. (from dual-colour transfer system described in (g)) (n = 7 per group). n, o, Flow cytometry analysis (left) and quantification of relative frequencies (normalized to co-transferred ‘spike’ cells; middle) and numbers (right) of NKG2A (Klrc1)+CD94 (Klrd1)+ (n, n = 5 per group) and CX3CR1+KLRG1+ (o, n = 8 per group) cells among donor-derived splenic P14 cells at day 21 p.i. (from dual-colour transfer system described in (g)). p, q, Quantification of frequencies of NKG2A (Klrc1)+CD94 (Klrd1)+ (p, n = 5 per group) and CX3CR1+KLRG1+ (q, n = 6 per group) cells among donor-derived splenic Texprog (Ly108+CX3CR1–), effector-like (Ly108–CX3CR1+) and Texterm (Ly108–CX3CR1–) cells (from dual-colour transfer system described in (g)). N.D., not detected. Data are pooled from two (m, o) or are representative of three (g and q), two (a–c, h–l, n and p) or one (d, e) independent experiments. NS, not significant; *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001; two-tailed unpaired Student’s t-test (a–c, g and i–q) or one-way ANOVA (h) or two-way ANOVA (e). Data are presented as mean ± SEM (a–c, e and g–q).

Source data

Extended Data Fig. 4 (related to Fig. 2). ZMYND8 deficiency reduces Texterm differentiation, promotes effector function in CD8+ T cells, and improves antiviral responses.

a, Experimental schematic for Texprog or effector-like cell secondary transfer assays. Cas9-expressing P14 cells transduced with sgNTC (Ametrine+) or sgZmynd8 (GFP+) were mixed at a 1:1 ratio and co-transferred into C57BL/6 mice, followed by LCMV Cl13 infection. At day 10 p.i., Texprog (Ly108+TIM-3−CX3CR1−) and effector-like (Ly108−TIM-3+CD101−) cells among sgNTC (Ametrine+) and sgZmynd8 (GFP+)-expressing P14 cells were sorted from the spleen, and equal mixtures (1:1) of sgNTC and sgZmynd8-expressing cells were co-transferred into new LCMV Cl13 infection-matched recipients. The frequency of each Tex subpopulation was assessed at day 19 p.i. (9 days post-secondary transfer) using flow cytometry. b, c, Quantification of relative frequencies (normalized to co-transferred ‘spike’ cells) of Texterm cells (TIM-3+CD101+) derived from the Texprog (b) or effector-like (c) cell secondary transfer assay described in (a) (n = 6 per group). d, Experimental schematic for Texprog or Texint cell secondary transfer assays. At day 10 p.i., Texprog (Ly108+TIM-3−CX3CR1−) and Texint (Ly108−CX3CR1+KLRG1−) cells among sgNTC (Ametrine+) and sgZmynd8 (GFP+)-expressing P14 cells were sorted from the spleen, and equal mixtures (1:1) of sgNTC and sgZmynd8-expressing cells were co-transferred into new LCMV Cl13 infection-matched recipients. The frequency of each Tex subpopulation was assessed at day 19 p.i. (9 days post-secondary transfer) using flow cytometry. e, f, Quantification of frequencies of TexKLR (CD94 (Klrd1)+NKG2D (Klrk1)+, e) and Texterm (TIM-3+CD101+, f) cells derived from the Texprog or Texint cells in the secondary transfer assay (n = 5 per group). g, Violin plots showing the expression of Gzma and Gzmb in sgNTC and sgZmynd8-expressing Texprog, effector-like and Texterm states among P14 cells from LCMV Cl13-infected mice at day 21 p.i. (as profiled by scRNA-seq) (n = 3,482 cells for sgNTC and 1,408 cells for sgZmynd8 Texprog clusters; 2,289 cells for sgNTC and 2,664 cells for sgZmynd8 effector-like clusters; and 1,998 cells for sgNTC and 596 cells for sgZmynd8 Texterm clusters). Log2FCs and adjusted P (Padj) values of sgZmynd8 versus sgNTC in effector-like and Texterm cells are provided. The boxes represent 25% to 75% interquartile range (IQR), and whiskers depict the minimum (25% quantile – 1.5* IQR) to maximum (75% quantile + 1.5* IQR) values. h, Volcano plot showing differentially expressed (|log2FC|> 0.4; bonferroni correction adjusted P < 0.05) genes in sgZmynd8-expressing effector-like cells compared with sgNTC-expressing effector-like cells from scRNA-seq profiling. i, j, Cas9-expressing P14 cells transduced with sgNTC or sgZmynd8 (Ametrine+) were mixed with sgNTC-transduced (‘spike’; GFP+) P14 cells at a 1:1 ratio and transferred to Cas9+ mice, followed by LCMV Cl13 infection (dual-colour transfer system). Relative frequencies (normalized to co-transferred ‘spike’ cells; right) of GZMA+ and GZMB+ cells among donor-derived splenic P14 cells at day 21 p.i. (i, n = 4 per group). Relative frequencies (normalized to co-transferred ‘spike’ cells) of GZMA+ (left) and GZMB+ (right) cells among donor-derived P14 cells in spleen, mLN, pLNs, liver and lung at day 21 p.i. (j, n = 6 per group). k, Cas9-expressing P14 cells transduced with sgNTC or the indicated Zmynd8-specific sgRNA (sgZmynd8.g1, sgZmynd8.g2, sgZmynd8.g3) (Ametrine+) were mixed at a 1:1 ratio with cells transduced with sgNTC (‘spike’; GFP+) and adoptively transferred to the same recipient Cas9+ mice, followed by LCMV Cl13 infection. Relative frequencies (normalized to co-transferred ‘spike’ cells) of GZMA+ (middle) and GZMB+ (right) cells among donor-derived splenic P14 cells at day 21 p.i. (n = 5 per group). l, m, sgNTC and sgZmynd8-expressing Texprog (Ly108+CX3CR1–), effector-like (Ly108–CX3CR1+) and Texterm (Ly108–CX3CR1–) cells were sorted from the spleen of the same host (from dual-colour transfer system) at day 21 p.i. Then, splenocytes from naïve C57BL/6 mice were pulsed with 0.2 µM gp33-41 peptide (gp33; target) or an irrelevant peptide (OVA257-264; non-target) at 37 °C for 1 h. Target and non-target cells were respectively labelled with 0.5 or 5 μM CellTrace Violet (CTV), mixed at a 1:1 ratio and incubated with the aforementioned sorted Tex subpopulations at an effector-to-target (E:T) ratio of 1:3 (or cultured without T cells) for 16 h. Experimental schematic of ex vivo killing assay (l). Flow cytometry analysis of CTVhi and CTVlo splenocytes with or without (labelled as splenocytes only) co-culture with Texprog (Ly108+CX3CR1–), effector-like (Ly108–CX3CR1+) or Texterm (Ly108–CX3CR1–) cells (m). n–q, To perform an in vivo killing assay, Cas9-expressing P14 cells transduced with sgNTC (Ametrine+) or sgZmynd8 (Ametrine+) were transferred into separate cohorts of recipient Cas9+ mice, followed by LCMV Cl13 infection (single-colour transfer system). Frequencies of gp33+ endogenous (gp33-tetramer+Ametrine–) cells and P14 (gp33-tetramer+Ametrine+) cells among splenic CD8+ T cells (n). Frequencies (right) of Texprog (Ly108+CX3CR1–), effector-like (Ly108–CX3CR1+) and Texterm (Ly108–CX3CR1–) cells among endogenous gp33-tetramer+ CD8+ T cells (Ametrine–) and donor-derived P14 cells (Ametrine+) (o). Frequencies (right) of TexKLR (CD94+NKG2D+ (p) or CX3CR1+KLRG1+ (q)) cells among endogenous gp33-tetramer+ CD8+ T cells (Ametrine–) and donor-derived P14 cells (Ametrine+) (n = 6 per group). r, Cas9-expressing P14 cells transduced with sgNTC (Ametrine+) or sgZmynd8 (Ametrine+) were transferred into separate recipient Cas9+ mice, followed by LCMV Cl13 infection (single-colour transfer system). Quantification of LCMV viral loads in serum and liver as measured by qPCR assay at day 21 p.i. (n = 15 per group). Data are pooled from two (r) or are representative of three (i), two (b, c, e, f, j, k and m–q) independent experiments. NS, not significant; *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001; two-tailed Wilcoxon rank sum test (g), two-tailed unpaired Student’s t-test (b, c, e, f, i, j and r), one-way ANOVA (k) or two-way ANOVA (n–q). Data are presented as mean ± SEM (b, c, e, f, i–k and n–r). Schematics in a,d,l were created in BioRender; Wang, Y. https://BioRender.com/3jr1r24 (2026).

Source data

Extended Data Fig. 5 (related to Figs. 2 and 3). ZMYND8 deficiency enhances STAT5 activity.

a, Activity score of STAT5CA Up signature (curated from GSE214116) in P14 cells from LCMV Cl13-infected mice at day 28 p.i. (in a public dataset GSE122713) visualized on UMAP. b, Violin plots showing the activity scores of STAT5CA Up signature (left) and STAT5CA Down signature (right) (curated from GSE214116) in sgNTC and sgZmynd8-expressing Texprog, effector-like and Texterm clusters (from the scRNA-seq dataset shown in Fig. 2a) at day 21 p.i. (n = 3,482 cells for sgNTC and 1,408 cells for sgZmynd8 Texprog clusters; 2,289 cells for sgNTC and 2,664 cells for sgZmynd8 effector-like clusters; and 1,998 cells for sgNTC and 596 cells for sgZmynd8 Texterm clusters). The boxes represent 25% to 75% interquartile range (IQR), and whiskers depict the minimum (25% quantile – 1.5* IQR) to maximum (75% quantile + 1.5* IQR) values. c, Epigenetic Landscape In Silico deletion Analysis (LISA) of the top 250 upregulated genes (ranked by log2FC) in sgZmynd8-expressing compared with sgNTC-expressing P14 cells (from scRNA-seq profiling described in Fig. 2a). Top 10 transcription factors with upregulated activity in sgZmynd8-expressing P14 cells are shown in the bar plot, with STAT5 highlighted in red. d, Empirical cumulative distribution plots for the change in expression (log2FC) of all genes (black line) in a public dataset of STAT5CA-expressing versus empty vector control P14 cells (GSE214116) compared with genes upregulated (log2FC > 0.3; red line) or downregulated (log2FC <–0.3; blue line) in ZMYND8-deficient compared with control P14 cells at day 21 p.i. (as profiled by scRNA-seq (described in Fig. 2a)). e, f, GSEA enrichment plot showing upregulation of STAT5CA Up signature in sgZmynd8-expressing P14 cells compared with sgNTC-expressing P14 cells from scRNA-seq dataset (e). Heatmap showing the 77 common leading-edge genes from the STAT5CA Up signature (shown in e) that were upregulated (log2FC > 0.5 adjusted P < 0.05) in sgZmynd8-expressing P14 cells (f). g, GSEA enrichment plot showing downregulation of STAT5CA Down signature in sgZmynd8-expressing P14 cells compared with sgNTC-expressing P14 cells from scRNA-seq dataset. h, Violin plots showing the activity scores of ZMYND8-activated (left) and ZMYND8-suppressed (right) signatures (see Methods) in CD8+ T cells from LCMV Cl13-infected mice treated with or without IL-2 (GSE206732) (n = 1,075 cells for untreated and 5,538 cells for IL-2 treatment). The boxes represent 25% to 75% interquartile range (IQR), and whiskers depict the minimum (25% quantile – 1.5* IQR) to maximum (75% quantile + 1.5* IQR) values. i–k, Cas9-expressing P14 cells transduced with sgNTC or sgZmynd8 were adoptively transferred into separate Cas9+ mice. The recipient mice were infected with LCMV Cl13 and then treated daily with either PBS or rhIL-2 (1.5 × 104 IU per mouse) at day 30–35 p.i., followed by flow cytometry analysis at day 36 p.i. Experimental schematic for adoptive transfer of P14 cells in combination with IL-2 therapy in the LCMV Cl13 infection model (i). Quantification of LCMV viral loads in serum (left), liver (middle) and kidney (right) (j, n = 12 per group). Quantification of frequency (left) and number (right) of Texterm (Ly108–CX3CR1–) cells among donor-derived splenic P14 cells in recipient mice (k, n = 5 per group). l–q, Experimental schematic for ATAC-seq profiling of Texprog and effector-like subpopulations. Cas9-expressing P14 cells transduced with either sgNTC (Ametrine+) or Zmynd8-specific sgRNA (sgZmynd8; GFP+) were mixed at a 1:1 ratio and then co-transferred into Cas9+ recipient mice (dual-colour transfer system) that were infected with LCMV Cl13. Texprog (Ly108+TIM-3–) and effector-like (Ly108–TIM-3+) cells were sorted at day 14 p.i. for ATAC-seq analysis (n = 4 per group) (l). Genome browser tracks showing differentially accessible chromatin regions at the Gzma (m), Gzmb (n) and Klre1 (o) gene loci in sgNTC and sgZmynd8-expressing Texprog (Ly108+TIM-3–) and effector-like (Ly108–TIM-3+) cells. Average signals of 4 biological replicates are shown. Blue boxes indicate regions with increased chromatin accessibility in ZMYND8-deficient effector-like cells compared with their control counterparts (m–o). Transcription factor motif enrichment analysis of differentially accessible chromatin regions (|odds ratio|> 1.5) in sgZmynd8-expressing compared with sgNTC-expressing Texprog (left) or effector-like (right) cells, ranked by odds ratio. Transcription factors with predicted increased and decreased activity are indicated in red and blue, respectively. For upregulated motifs, the top 5-ranking motifs and STAT5 are labelled (p). Peak enrichment analysis of ATAC-seq data, showing top enriched pathways based on the genes nearest to the upregulated (log2FC > 0.5 and P < 0.05) peaks in sgZmynd8-expressing Texprog (left column) or effector-like cells (right column) compared with sgNTC-expressing counterparts (q). Data are pooled from two (j) or are representative of three (k) independent experiments. NS, not significant; *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001; two-tailed Wilcoxon rank sum test (b and h), Kolmogorov-Smirnov tests (d), two-way ANOVA (j and k) or two-tailed Fisher’s exact test (q). Data are presented as mean ± SEM (j and k). Schematics in i,l were created in BioRender; Wang, Y. https://BioRender.com/3jr1r24 (2026).

Source data

Extended Data Fig. 6 (related to Fig. 3). Characterizations of STAT5 activity and IL-2R expression in ZMYND8-deficient CD8+ T cell populations.

a–e, Cas9-expressing P14 cells transduced with either sgNTC (Ametrine+) or Zmynd8-specific sgRNA (sgZmynd8; GFP+) were mixed at a 1:1 ratio and then co-transferred into Cas9+ recipient mice (dual-colour transfer system) that were infected with LCMV Cl13. At day 21 p.i., sgNTC and sgZmynd8-expressing P14 cells were sorted from LCMV Cl13-infected mice and profiled by multiome analysis that combines single-cell ATAC-seq (scATAC-seq) with single-nuclear RNA-seq (snRNA-seq). UMAP plot depicting the four Tex states as defined by their molecular signatures (left; a). Dot plot showing the relative expression of Texprog, Texint, TexKLR and Texterm cell-associated genes (right; a). UMAP plot of snRNA-seq data depicting the distribution of sgNTC and sgZmynd8-expressing P14 cells (b). Quantification of the relative proportions of four Tex states among sgNTC and sgZmynd8-expressing P14 cells (c). Genome browser tracks showing differentially accessible chromatin regions at the Gzma, Gzmb, Klre1 and Cd101 gene loci in sgNTC and sgZmynd8-expressing P14 cells (from scATAC-seq data). Blue boxes indicate regions with altered chromatin accessibility in ZMYND8-deficient P14 cells compared with control cells (d). Volcano plots showing inferred differential transcription factor activities based on motif enrichment analysis (computed using ChromVAR; see Methods) in sgZmynd8-expressing compared with sgNTC-expressing total P14 cells (first panel) or their Texprog (second panel), effector-like (third panel) or Texterm (fourth panel) subpopulations. Transcription factors with predicted increased (log2FC > 0.7, bonferroni correction adjusted P < 0.05) and decreased (log2FC <–0.7, bonferroni correction adjusted P < 0.05) activities are indicated in red and blue, respectively. STAT5 transcription factor motifs are labelled (e). f, Flow cytometry analysis (left) and quantification of relative frequency (normalized to co-transferred ‘spike’ cells; right) of TOX+ cells among donor-derived P14 cells in spleen, mLN, pLNs, liver and lung at day 21 p.i. (from dual-colour transfer system) (n = 6 per group). g, Quantification of relative frequency (normalized to co-transferred ‘spike’ cells) of TOX+ cells among donor-derived P14 cells at day 90 p.i. (from dual-colour transfer system) (n = 5 per group). h, Dot plot showing Il2ra (left) and Il2rb (right) expression in sgNTC-expressing Texprog, Texint, TexKLR and Texterm states at day 21 p.i. (based on scRNA-seq profiling described in Fig. 2a). i, j, Flow cytometry analysis (left) and quantification (right) of frequencies of CD25+ cells (i, n = 7 per group) and gMFIs of CD122 (j, n = 8 per group) among Texprog (Ly108+CX3CR1–), Texint (CX3CR1+KLRG1–), TexKLR (CX3CR1+KLRG1+) and Texterm (Ly108–CX3CR1–) subpopulations of sgNTC-expressing P14 cells at day 21 p.i. (dual-colour transfer system) k, Real-time PCR analysis of relative Il2ra mRNA levels (normalized to expression in sgNTC-expressing Texprog) in sgNTC and sgZmynd8-expressing Texprog and effector-like cells sorted from the spleen (from dual-colour transfer system) at day 14 p.i. (n = 6 per group). l, m, Quantification of relative frequencies (normalized to co-transferred ‘spike’ cells) of CD25+ (l, n = 7 per group) or flow cytometry analysis (left) and quantification of relative gMFIs (normalized to that in co-transferred ‘spike’ cells for each population; right) of CD122 (m, n = 6 per group) in donor-derived splenic total P14 cells and Texprog (Ly108+CX3CR1–), effector-like (Ly108–CX3CR1+) and Texterm (Ly108–CX3CR1–) subpopulations (from dual-colour transfer system) at day 21 p.i. n, o, Naïve P14 cells electroporated with sgNTC or sgZmynd8 and Cas9 RNPs (CD45.2+) were mixed with sgNTC-expressing (‘spike’; CD45.1+CD45.2+) P14 cells at a 1:1 ratio, and co-transferred into CD45.1+ Cas9+ mice, followed by LCMV Cl13 infection one day later (n = 5 per group). Quantification of relative frequencies (normalized to co-transferred ‘spike’ cells) of CD25+ (n), or flow cytometry analysis (left) and quantification of relative gMFIs (normalized to that in co-transferred ‘spike’ cells for each population; right) of CD122 (o) in donor-derived splenic P14 cells and Texprog (Ly108+CX3CR1–), effector-like (Ly108–CX3CR1+) and Texterm (Ly108–CX3CR1–) subpopulations at day 21 p.i. Data are pooled from two (l, m) or are representative of three (k) or two (f, g, i, j, n and o) independent experiments. NS, not significant; **P < 0.01, ***P < 0.001 and ****P < 0.0001; two-tailed Wilcoxon rank sum test (e), two-tailed unpaired Student’s t-test (f, g and l–o), one-way ANOVA (i, j) or two-way ANOVA (k). Data are presented as mean ± SEM (f, g and i–o).

Source data

Extended Data Fig. 7 (related to Fig. 3). ZMYND8 deficiency antagonizes exhaustion in human CD8+ T cells.

a, Experimental schematic of in vitro acute and chronic stimulation of human gene-edited CD8+ T cells. Naïve human CD8+ T cells were activated with ImmunoCult™ Human CD3/CD28 T Cell Activator (12.5 μl ml–1) for 2 days and then electroporated with sgNTC or sgZMYND8 together with Cas9 RNPs. Then, sgNTC and sgZMYND8-expressing human CD8+ T cells were stimulated with IL-2 alone (50 IU ml−1; termed acute stimulation) or in combination with plate-bound anti-human CD3 antibody (2 μg ml–1; termed chronic stimulation). Fresh medium containing IL-2 was added every 2 days (for acute stimulation) or cells in IL-2-containing medium were replated onto fresh anti-human CD3 antibody-coated plates every 2 days (for chronic stimulation). Cells were collected and analysed by flow cytometry on day 30 after acute or chronic stimulation. Intracellular staining for cytokines (e.g., IFNγ) or GZMB in human CD8+ T cells cultured under both acute and chronic stimulation conditions was performed after stimulation with ionomycin and phorbol 12-myristate 13-acetate (PMA) in the presence of GolgiStop for 4 h. See also Methods. Created in BioRender; Wang, Y. https://BioRender.com/3jr1r24 (2026). b–h, Quantification of gMFIs of PD-1, TIM-3 and TOX (b) and frequencies of IFNγ+ and GZMB+ cells (c) in sgNTC-expressing human CD8+ T cells (n = 3 technical replicates per group). Flow cytometry analysis (left) and quantification (right) of the frequency of CD25+ cells and gMFI of CD122 in sgNTC and sgZMYND8-expressing human CD8+ T cells (d, n = 7 per group). Flow cytometry analysis of the frequencies of PD-1+ (e), TOX+ (f), IFNγ+TNF+ (g) and GZMB+ (h) cells among sgNTC and sgZMYND8-expressing human CD8+ T cells (see also Fig. 3h, i for quantification). i, Activated human CD8+ T cells electroporated with sgNTC or the indicated ZMYND8-specific sgRNA (sgZMYND8.g1, sgZMYND8.g2 and sgZMYND8.g3; sgZMYND8.g1 was used in b–h) together with Cas9 RNPs were rested for 2 days and then cultured with IL-2 (50 IU ml−1) for 2 days. Immunoblot analysis of ZMYND8 levels in the indicated human CD8+ T cells. ACTB was used as a loading control. Densitometric quantification of ZMYND8 is shown. For gel source data, see Supplementary Fig. 2. j–q, Human CD8+ T cells expressing sgNTC or the indicated ZMYND8-targeting sgRNA (i.e. sgZMYND8.g1, sgZMYND8.g2 and sgZMYND8.g3) were subjected to acute or chronic stimulations in vitro, followed by flow cytometry analysis on day 30 after acute or chronic stimulation (n = 5 biological replicates from individual donors per group). Flow cytometry analysis (left) and quantification (right) of the frequency of CD25+ cells (j), gMFI of CD122 (k), and frequency of phosphorylated STAT5 (p-STAT5)+ cells (l) among sgNTC and sgZMYND8-expressing human CD8+ T cells. Quantification of frequencies of PD-1+ and TOX+ cells (m) or IFNγ+ and GZMB+ cells (n) among sgNTC and sgZMYND8-expressing human CD8+ T cells. For quantification of IFNγ+ and GZMB+ cells in (n), cells were restimulated with PMA and ionomycin for 4 h in the presence of GolgiStop prior to performing intracellular staining. Flow cytometry analysis (left) and quantification of the frequencies (right) of Ki67+ cells (o), and quantification of the frequencies of active caspase-3+ cells (p) among sgNTC and sgZMYND8-expressing human CD8+ T cells on day 30 after chronic stimulation. Quantification of numbers of sgNTC and sgZMYND8.g1-expressing human CD8+ T cells on days 0, 6, 12, 18, 24 and 30 after chronic stimulation. Equal numbers of cells (3 × 105) were plated for each group on day 0 (q). Data are pooled from two (d) or are representative of three (b, c, e and f), two (g, h) or one (i–q) independent experiments. NS, not significant; *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001; two-tailed unpaired Student’s t-test (b–d and q), one-way ANOVA (j–l, o and p) or two-way ANOVA (m, n). Data are presented as mean ± SEM (b–d and j–q).

Source data

Extended Data Fig. 8 (related to Fig. 3) Blockade of IL-2R reverses the increase in effector-like state caused by ZMYND8 deficiency.

a–e, Cas9-expressing P14 cells transduced with sgNTC or sgZmynd8 (both GFP+)-expressing retrovirus together with sgNTC or sgStat5b (both Ametrine+). Co-transduced P14 cells (Ametrine+GFP+) were mixed with sgNTC-expressing P14 (‘spike’; Ametrine+) at a 1:1 ratio and then co-transferred into Cas9+ recipient mice, followed by LCMV Cl13 infection (dual-colour transfer system). Co-transduced (Ametrine+GFP+) P14 cells were analysed by immunoblot at day 7 p.i. (b) or flow cytometry at day 21 p.i. (c–e; see also Fig. 3j–l). a, Experimental schematic for flow cytometry analysis. Created in BioRender; Wang, Y. https://BioRender.com/3jr1r24 (2026). Immunoblot analysis of ZMYND8 and STAT5B protein levels in the indicated co-transduced (Ametrine+GFP+) splenic P14 cells. ACTB was used as the loading control. Densitometric quantifications of ZMYND8 and STAT5B are shown. For gel source data, see Supplementary Fig. 2 (b). Quantification of relative gMFIs (normalized to that of co-transferred ‘spike’ cells) of GZMA (upper left) and GZMB (upper right) or relative frequency (normalized to co-transferred ‘spike’ cells) of IFNγ+ cells (lower left) in donor-derived splenic P14 cells at day 21 p.i. (c, n = 7 per group). Quantification of relative frequencies (normalized to co-transferred ‘spike’ cells) and numbers of Texprog (Ly108+CX3CR1–, left two panels) and Texterm (Ly108–CX3CR1–, right two panels) cells among donor-derived splenic P14 cells at day 21 p.i. (d, n = 6 per group). Flow cytometry analysis (left) and quantification of relative frequencies (normalized to co-transferred ‘spike’ cells; middle) and numbers (right) of Texterm (TIM-3+CD101+) (e, n = 6 per group). f, Cas9-expressing P14 cells transduced with sgNTC or sgZmynd8 (both GFP+)-expressing retrovirus together with sgNTC or sgIl2ra (both Ametrine+) and co-transferred into LCMV Cl13-infected mice (as described in a–e). Immunoblot analysis of ZMYND8 and CD25 protein levels in the indicated co-transduced (Ametrine+GFP+) splenic P14 cells at day 7 p.i. GAPDH was used as the loading control. Densitometric quantifications of ZMYND8 and CD25 are shown. For gel source data, see Supplementary Fig. 2. g–o, Cas9-expressing P14 cells transduced with sgNTC or sgZmynd8 (both GFP+)-expressing retrovirus together with sgNTC, sgIl2ra (h–j and n) or sgIl2rb (g, k–m and o) (all Ametrine+) and co-transferred into LCMV Cl13-infected mice, followed by analysis at day 21 p.i. (as described in a–e). Flow cytometry analysis (left) and quantification of the frequencies of CD122+ (g, n = 5 per group). Flow cytometry analysis (left) and quantification of the relative frequency (normalized to co-transferred ‘spike’ cells; middle) and number (right) of effector-like (Ly108–CX3CR1+) cells among donor-derived P14 cells (h, k; n = 8 per group). Flow cytometry analysis (left) and quantification of the relative frequency (normalized to co-transferred ‘spike’ cells; right) of TexKLR (CD94 (Klrd1)+NKG2D (Klrk1)+) cells among donor-derived P14 cells (i, l; n = 8 per group). Quantification of the relative frequency (normalized to co-transferred ‘spike’ cells) of TOX+ cells among donor-derived P14 cells (j, m; n = 8 per group). Quantification of relative frequencies (normalized to co-transferred ‘spike’ cells) and numbers of Texprog (Ly108+CX3CR1–, left two panels) and Texterm (Ly108–CX3CR1–, right two panels) cells among donor-derived splenic P14 cells (n, o; n = 8 per group). Data are pooled from two (c and h–o) or are representative of three (d, e), two (g) or one (b, f) independent experiments. The sgNTC and sgZmynd8 groups in i and l include data from one experimental cohort shared with Figs. 2d and 3k, respectively. NS, not significant; *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001; one-way ANOVA (c–e and g–o). Data are presented as mean ± SEM (c–e and g–o).

Source data

Extended Data Fig. 9 (related to Fig. 4) ZMYND8 requires its histone reader domains to repress p300-mediated transcriptional activation of IL-2R.

a–d, Cas9-expressing P14 cells transduced with sgNTC (Ametrine+) were adoptively transferred to Cas9+ recipient mice, followed by LCMV Cl13 infection. At day 7 p.i., sorted P14 cells were profiled by CUT&RUN assays to identify binding sites for ZMYND8 or peaks of specific histone modifications as indicated in each panel (n ≥ 2 per group; see Methods). Genome browser tracks showing control IgG and αZMYND8 CUT&RUN signals at the Il2ra (upper) and Il2rb (lower) gene loci (a). Feature annotation of ZMYND8 binding sites and H3K4me1, H3K27Ac, H3K14Ac, H3K36me2, H4K16Ac and H3K4me3 histone marks in P14 cells (b). Intersected sizes of ZMYND8 binding sites with H3K14Ac, H4K16Ac, H3K36me2, H3K4me3, H3K27Ac and H3K4me1 histone marks at day 7 p.i. from CUT&RUN assay. P values indicate the significance of overlap between ZMYND8 binding sites and H3K4me1 or H3K27Ac histone marks (c). Genome browser tracks showing CUT&RUN signals of control IgG, αZMYND8, αH3K14Ac, αH3K36me2, αH4K16Ac and αH3K4me3 at the Il2ra (upper) and Il2rb (lower) gene loci (d). The same IgG and αZMYND8 browser tracks are shown in (d) and Fig. 4c,d. The red boxes indicate the enhancer regions in these gene loci bound by ZMYND8 (d). e, f, Mice received adoptive transfer of P14 cells and LCMV Cl13 infection as described in (a–d). At day 21 p.i., isotype IgG control or αH3K27Ac CUT&RUN assays were performed in Texprog (Ly108+CX3CR1–; n = 1), effector-like (Ly108–CX3CR1+; n = 2) and Texterm (Ly108–CX3CR1–; n = 2) cells that were sorted from sgNTC-expressing P14 cells. Heatmap showing normalized average H3K27Ac CUT&RUN signals within ZMYND8-bound active enhancer regions of the Il2ra locus (based on αZMYND8 CUT&RUN signals from total P14 cells at day 7 p.i.) in Texprog, effector-like and Texterm cells at day 21 p.i. (e). CUT&RUN-qPCR analysis of relative H3K27Ac binding levels within ZMYND8-bound active enhancer regions of the Il2ra locus (normalized to IgG control in Texterm cells) in Texprog, effector-like and Texterm subpopulations sorted from sgNTC-expressing P14 cells at day 21 p.i. (n = 4 for Texprog and Texterm groups; 8 for effector-like group) (f). g, Real-time PCR analysis of relative Il2ra mRNA levels (normalized to expression in Texprog cells) in Texprog, effector-like and Texterm subpopulations of sgNTC-expressing P14 cells sorted from the spleen at day 21 p.i. as described in (e) (n = 8 per group). h, i, Cistrome transcriptional regulator enrichment analysis (http://dbtoolkit.cistrome.org/) of the ZMYND8-bound regions identified in CUT&RUN assay. Top 10 histone modifications (h) and chromatin regulators (i) (ranked by GIGGLE score) are displayed. j–l, Cas9-expressing P14 cells transduced with sgNTC (Ametrine+) were mixed at a 1:1 ratio with cells transduced with sgZmynd8 (GFP+) and co-transferred into Cas9+ mice, followed by LCMV Cl13 infection. At day 7 p.i., sorted P14 cells were profiled by CUT&RUN assay to identify binding sites for p300, ZMYND8 and H3K27Ac (n = 2 per group; see Methods). Genome browser tracks showing αp300, αZMYND8, and αH3K27Ac CUT&RUN signals at the Il2rb gene loci in sgNTC and sgZmynd8-expressing P14 cells. The red box indicates the active enhancer region with overlapping signals for ZMYND8 (j). CUT&RUN-qPCR analysis to quantify relative occupancy of ZMYND8, p300 and H3K27Ac at the Il2ra (k) and Il2rb (l) active enhancer regions (normalized to IgG control in sgNTC cells) in sgNTC and sgZmynd8-expressing P14 cells (sorted from the spleen at day 7 p.i.) (n = 6 per group). m, Cell lysates from in vitro activated P14 cells were immunoprecipitated with normal rabbit IgG control or αZMYND8 antibody. Immunoblot analysis of p300 and ZMYND8 in the immunoprecipitated samples (upper) or whole cell lysates (input; lower). ACTB was used as a loading control. For gel source data, see Supplementary Fig. 2. IB, immunoblot. n, Schematic of the known functional domains of ZMYND8, including the N-terminal PHD–BRD–PWWP histone reader domains and a C-terminal MYND-interacting domain. PHD, plant homeodomain; BRD, bromodomain; PWWP, Pro-Trp-Trp-Pro; MYND, myeloid, nervy, and DEAF-1 (deformed epidermal autoregulatory factor 1). o, Jurkat cells were nucleofected with luciferase reporter constructs (Renilla control and Firefly containing either a scrambled sequence or the IL2RA enhancer CaRE4 sequence upstream of a generic minimal promoter) in combination with p300 or ZMYND8 (wild-type (WT) or mutants lacking the PHD (ΔPHD), BRD (ΔBRD), PWWP (ΔPWWP), triple reader cassette (ΔPHD–BRD–PWWP), or MYND (ΔMYND) domains)-expressing plasmids. At 18–20 h after nucleofection, cells were split to a stimulation plate pre-coated with anti-human CD3 (10 μg ml−1) and anti-human CD28 (10 μg ml−1) or an untreated control plate (indicated as untreated). Cells were lysed 24 h after stimulation, followed by measurement of luciferase activity. Quantification of normalized luciferase activity (Firefly luciferase signal relative to Renilla luciferase signal) (n = 5 per group). p, V5-tagged ZMYND8 (WT or indicated mutants) (or empty vector (EV)) were transfected with His-tagged p300 (or EV) in HEK293T cells. Cell lysates from HEK293T cells transfected with indicated plasmids were immunoprecipitated (IP) with anti-V5 antibody, followed by immunoblot analysis to detect the interaction between ZMYND8 (WT or indicated mutants) and p300. Immunoblot analysis of V5 (for ZMYND8), His (for p300) and p300 in the immunoprecipitated samples (upper) or whole cell lysates (input; lower). ACTB was used as a loading control. Densitometric quantification of immunoprecipitated protein (normalized to input protein from the whole cell lysate) is shown. For gel source data, see Supplementary Fig. 2. Data are pooled from two (f, g) or are representative of two (a–d, j–m, o and p) independent experiments. NS, not significant; *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001; two-tailed Fisher’s exact test (c), two-tailed unpaired Student’s t-test (k, l), one-way ANOVA (f, g) or two-way ANOVA (o). Data are presented as mean ± SEM (f, g, k, l and o).

Source data

Extended Data Fig. 10 (related to Fig. 4). ZMYND8–p300 epigenetic axis orchestrates CD8+ T cell differentiation.

a, Percentages of indicated Tex states in sgNTC and sgEp300-expressing P14 cells as assessed by scCRISPR screening. b, Contour density plots on UMAPs showing distributions of sgNTC and the three individual Ep300-targeting sgRNAs (indicated as g1, g2, and g3) in Tex states from scCRISPR screening (see also Fig. 1b). Corresponding numbers of recovered cells for each sgRNA are shown. The sgNTC contour plot is also presented in Extended Data Fig. 1w. c, Immunoblot analysis of p300 protein levels in sgNTC or indicated sgEp300-transduced Cas9+ P14 cells isolated from the spleen at day 7 p.i. ACTB was used as a loading control. Densitometric quantification of p300 is shown. For gel source data, see Supplementary Fig. 2. d–g, Cas9-expressing P14 cells transduced with sgNTC or the indicated Ep300-specific sgRNA (Ametrine+) were mixed at a 1:1 ratio with cells transduced with sgNTC (‘spike’; GFP+) and adoptively transferred to the same recipient Cas9+ mice, followed by LCMV Cl13 infection (dual-colour transfer system) and analysis at day 21 p.i. (n = 6 per group). Flow cytometry analysis (d) and quantification of relative frequencies (normalized to co-transferred ‘spike’ cells) and numbers (e) of Texprog (Ly108+CX3CR1–; left two panels), effector-like (Ly108–CX3CR1+; middle two panels) and Texterm (Ly108–CX3CR1–; right two panels) cells among donor-derived splenic P14 cells. Quantification of relative frequency and number of TexKLR (CD94+NKG2D+) cells among donor-derived splenic P14 cells (f). Quantification of relative frequency (normalized to co-transferred ‘spike’ cells) of CD25+ cells among donor-derived splenic P14 cells (g). h–j, Cas9-expressing P14 cells transduced with sgNTC or sgZmynd8 (GFP+)-expressing retrovirus together with sgNTC or sgEp300 (specifically sgEp300.g2; Ametrine+). Co-transduced P14 cells (Ametrine+GFP+) were mixed with sgNTC-expressing P14 (‘spike’; Ametrine+) at a 1:1 ratio and then co-transferred into Cas9+ recipient mice, followed by LCMV Cl13 infection (dual-colour transfer system). Immunoblot analysis of ZMYND8 and p300 protein levels in the indicated co-transduced (Ametrine+GFP+) P14 cells isolated from the spleen at day 7 p.i. ACTB was used as the loading control. Densitometric quantifications of ZMYND8 and p300 are shown. For gel source data, see Supplementary Fig. 2 (h). Quantification of relative frequencies (normalized to co-transferred ‘spike’ cells) and numbers of Texprog (Ly108+CX3CR1–, i) and Texterm (Ly108–CX3CR1–, j) cells among donor-derived splenic P14 cells at day 21 p.i. (n = 7 per group). Data are pooled from two (i, j) or are representative of two (d–g) or one (c, h) independent experiments. NS, not significant; *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001; one-way ANOVA (e–g, i and j). Data are presented as mean ± SEM (e–g, i and j).

Source data

Extended Data Fig. 11 (related to Fig. 5). ZMYND8 expression and activity are elevated in the Texterm state, and ZMYND8 deficiency increases STAT5 activation in CAR T cells.

a, Zmynd8 (left) and Tox (right) expression in sgNTC-expressing Texprog, Texint, TexKLR and Texterm at day 28 p.i. (from scCRISPR screening). The log2FCs between TexKLR compared with other three Tex states are shown (n = 170 for Texprog, 256 for Texint, 480 for TexKLR and 186 for Texterm cells). b, Zmynd8 expression in Texprog, Texint, TexKLR and Texterm cells at day 21 p.i. (from the in-house scRNA-seq dataset). c, UMAP depicting Texprog, Texint, TexKLR and Texterm cells in P14 cells from LCMV Cl13-infected mice at day 28 p.i. (left). Right, dot plot showing Zmynd8 expression in Texprog, Texint, TexKLR and Texterm cells (from GSE122712). d, Violin plots showing activity scores of ZMYND8-activated (left) and ZMYND8-suppressed (right) signatures in Texprog, Texint, TexKLR and Texterm cells at day 21 p.i. (from the in-house scRNA-seq dataset) (n = 2,845 for Texprog, 5,289 for Texint, 6,604 for TexKLR and 4,294 for Texterm cells). e, Violin plots showing activity scores of ZMYND8-activated (left) and ZMYND8-suppressed (right) signatures in Texprog, Texint, TexKLR and Texterm cells at day 28 p.i. (from GSE122712) (n = 2,095 for Texprog, 2,308 for Texint, 1,264 for TexKLR and 3,410 for Texterm cells). f, UMAPs showing ZMYND8, ENTPD1, EOMES, TIGIT and PDCD1 expression in CD8+ T cells from the peripheral blood of human HIV-infected patients or healthy human donors (from a public scRNA-seq dataset (GSE157829)) (left). CD8+ T cells from healthy donor (red) or HIV-infected individuals with low (green) and high (blue) viral titers are colour coded. Dashed lines indicate CD8+ T cells with co-expression of ZMYND8, ENTPD1, EOMES, TIGIT and PDCD1. Violin plots showing activity scores of ZMYND8-activated signature in CD8+ T cells from the peripheral blood of healthy donors and HIV-infected individuals with low and high viral titers (right) (n = 1,453 cells for healthy donors, 3,337 cells for HIV low titers and 4,308 cells for HIV high titers). g, h, Violin plots showing activity scores of ZMYND8-activated (left) and ZMYND8-suppressed (right) signatures (g; n = 2,895 for Texprog cells, 776 for effector-like cells and 1,700 for Texterm cells) and dot plot depicting expression of Zmynd8 (h) in Texprog, effector-like and Texterm cells among intratumoral OT-I cells from B16-OVA tumours on day 7 after adoptive transfer (from GSE216909). i, Violin plots showing activity scores of ZMYND8-activated (left) and ZMYND8-suppressed (middle) signatures in Texprog, Texint and Texterm cells among H2Db-gp33 specific CD8+ T cells from an autochthonous lung tumour model (n = 718 for Texprog cells, 636 for Texint cells and 402 for Texterm cells). Dot plot showing relative expression of Tox, Havcr2, Pdcd1, Tigit, Tcf7 and Slamf6 in Texprog, Texint and Texterm cells (right) (from GSE164177). j, Heatmap showing relative expression of ZMYND8-activated and ZMYND8-suppressed signatures (upper) and expression of Tcf7, Tox, Pdcd1 (lower) in tumour-specific CD8+ T cells from a genetically engineered mouse model (GEMM) of liver cancer at days 5 to 60 after tumour induction (from GSE89307)). k, Violin plots showing activity scores of ZMYND8-activated (left) and ZMYND8-suppressed (middle) signatures (n = 3,978 for naïve-like cells, 3,915 for transitional cells and 2,015 for dysfunctional cells), as well as dot plot depicting expression of ZMYND8 (right), in naïve-like, transitional and dysfunctional subpopulations of CD8+ T cells from patients with melanoma (from GSE123139). In (d–g, i and k), the boxes represent 25% to 75% interquartile range (IQR), and whiskers depict the minimum (25% quantile – 1.5* IQR) to maximum (75% quantile + 1.5* IQR) values. l, Immunoblot analysis of ZMYND8 and ACTB protein expression in activated P14 cells restimulated with anti-CD3 (1 μg ml–1) for the indicated times. Densitometric quantification of ZMYND8 is shown. For gel source data, see Supplementary Fig. 2. m–o, Cas9-expressing CAR T cells that recognize human CD19 (hCD19) were transduced with sgNTC or sgZmynd8 (Ametrine+; 2 × 106 cells), mixed with sgNTC-transduced (‘spike’; GFP+; 2 × 106 cells) CAR T cells at a 1:1 ratio, and co-transferred to the same C57BL/6 mice (for a total of 4 × 106 cells per mouse) on day 7 after B16-hCD19 tumour inoculation (5 × 105 cells per mouse). The intratumoral CAR T cells were analysed on day 20 after B16-hCD19 tumour inoculation (n = 6 per group). Quantification of the relative frequency (normalized to co-transferred ‘spike’ cells) of CD25+ cells (left) and relative gMFI (normalized to co-transferred ‘spike’ cells) of CD122 (right) among intratumoral CAR T cells (m). Quantification of relative frequencies (normalized to co-transferred ‘spike’ cells) of p-STAT5+ (left) and TOX+ (right) cells among intratumoral CAR T cells (n). Quantification of relative frequencies (normalized to co-transferred ‘spike’ cells) of NKG2D (Klrk1)+ in total CAR T cells and their Ly108+TIM-3– and Ly108–TIM-3+ subpopulations (o). Data are representative of three (l–o) independent experiments. Two-tailed Wilcoxon rank sum test (a, d–g, i and k). ***P < 0.001 and ****P < 0.0001; two-tailed unpaired Student’s t-test (m–o). Data are presented as mean ± SEM (m–o).

Source data

Extended Data Fig. 12 (related to Fig. 5). Targeting ZMYND8 in CD8+ T cells enhances IL-2- and ICB-mediated antitumour responses.

a–c, Cas9-expressing P14 cells transduced with sgNTC or sgZmynd8 were transferred individually to C57BL/6 mice as described in the experimental schematic (a). B16-gp33 tumour growth (b) and mouse survival (c). d, Survival of B16-gp33 tumour-bearing mice that received Cas9-expressing P14 cells transduced with sgNTC or sgZmynd8 (4 × 106 cells per mouse) on day 7 after B16-gp33 tumour inoculation (5 × 105 cells per mouse). e, f, Violin plots showing the activity scores of ZMYND8-activated and ZMYND8-suppressed signatures in CD8+ T cells from B16F10-B2m–/– melanoma-bearing mice treated with vehicle and mRNA-encoded IL-2 (https://zenodo.org/records/10604293) (e; n = 324 cells for vehicle and 2,050 cells for IL-2 treatment) or T3 sarcoma tumours at day 2 after treatment with vehicle and IL-2 (GSE252650) (f; n = 4,908 cells for vehicle and 6,488 cells for IL-2 treatment). g–i, Experimental schematic for adoptive transfer of P14 cells in combination with IL-2 therapy in tumours (g). Mouse survival of B16-gp33 tumour-bearing mice (see tumour growth curves in Fig. 5h) (h). B16-gp33 tumour growth curves in mice receiving sgNTC and sgZmynd8.g1-expressing P14 cells (i). j, Survival of B16F10 tumour-bearing mice that received Cas9-expressing pmel cells transduced with sgNTC or sgZmynd8 (4 × 106 cells per mouse) on day 8 after inoculation with B16F10 melanoma cells (5 × 105 cells per mouse), followed by treatment with PBS or rhIL-2 (as described in (g)). k, Percentages of memory, ICB-induced activated and exhausted cells in CD8+ T cells from patients with advanced basal cell carcinoma (BCC) pre-ICB and post-ICB treatment (from GSE123813). l, Violin plots showing the activity scores of ZMYND8-activated and ZMYND8-suppressed signatures (n = 5,333 for memory, 1,272 for activated, and 4,764 for exhausted cells), and dot plot depicting expression of ZMYND8 in indicated CD8+ T cell subpopulations in tumours from patients with squamous cell carcinoma (SCC; GSE123813). m, Dot plot depicting activity scores of ZMYND8-activated and ZMYND8-suppressed signatures in intratumoral CD8+ T cells from ICB-treated (or untreated) colorectal cancer patients with or without a pathological complete response (pCR) (GSE205506). n, o, Correlation matrix displaying the expression of the ZMYND8-activated signature (n) or the expression of ZMYND8 (o) and genes associated with responsiveness to anti-PD-1 therapy in melanoma patients (GSE120575). Kendall rank order correlations are displayed from blue to red. Genes positively (+; orange) or negatively (−; green) associated with response to anti-PD-1 blockade are indicated. p–u, Experimental schematic for adoptive transfer of P14 cells in combination with anti-PD-L1 treatment in tumours (p). Frequencies of CD25+ cells among Ly108+TIM-3– and Ly108–TIM-3+ subpopulations of intratumoral P14 cells from B16-gp33 tumours on day 34 after tumour inoculation (q, n = 6 per group). Frequency of TOX+ cells among intratumoral P14 cells from B16-gp33 tumours on day 20 (r, n = 7 per group) or day 34 (s, n = 6 per group) after tumour inoculation. Survival analysis of B16-gp33 tumour-bearing mice (see tumour growth curves in Fig. 5m) (t). B16-gp33 tumour growth curves in mice receiving sgNTC and sgZmynd8.g1-expressing P14 cells in combination with anti-PD-L1 treatment (u). v, Cas9-expressing P14 cells transduced with sgNTC or sgZmynd8 (Ametrine+) were adoptively transferred to separate Cas9+ recipient mice that were infected with LCMV Cl13 (single-colour transfer system), followed by intraperitoneal injections of IgG isotype control or anti-PD-L1 antibody (200 μg per mouse) on days 13, 16, 19, 22 and 25 p.i. Quantification of LCMV viral loads in indicated tissues at day 28 p.i. (n = 9 for sgNTC + isotype and sgZmynd8 + isotype groups; 12 for sgNTC + anti-PD-L1 and sgZmynd8 + anti-PD-L1 groups). w, ZMYND8 acts as an epigenetic rheostat imposing ‘signal 1’ (chronic antigen stimulation)-induced suppression of ‘signal 3’ cytokine signalling to enforce T cell exhaustion. Left, ZMYND8 expression and activity are a common hallmark of exhausted CD8+ T cells in both chronic infection and cancer, with ZMYND8 upregulation driven by chronic TCR stimulation. Targeting ZMYND8 promotes the differentiation of effector-like cells (especially TexKLR cells) at the expense of Texterm cells, and cooperatively enhances antiviral and antitumour immunity with IL-2 and ICB therapies (left). Right, ZMYND8 selectively binds certain active enhancers marked by H3K27Ac and H3K4me1 that are co-occupied by the histone acetyltransferase p300, including those within the Il2ra gene locus. ZMYND8 co-binding limits p300-driven H3K27Ac deposition and enhancer activation required for high-affinity IL-2Rα expression and downstream STAT5 signalling, resulting in high TOX levels and terminal exhaustion. In (e, f and l), the boxes represent 25% to 75% interquartile range (IQR), and whiskers depict the minimum (25% quantile – 1.5* IQR) to maximum (75% quantile + 1.5* IQR) values. Data are pooled from two (v) or are representative of three (d and q–s), two (b, c, h, j and t) or one (i, u) independent experiments. NS, not significant; *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001; two-tailed Wilcoxon rank sum test (e, f and l), Mantel-Cox test (c, d, h, j and t) or two-way ANOVA (b, i, q–s, u and v). Data are presented as mean ± SEM (q–s and v). Schematics in a,g,p,w were created in BioRender; Wang, Y. https://BioRender.com/3jr1r24 (2026).

Source data

Supplementary information

Source data

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Wang, Y., Shi, H., Chapman, N.M. et al. Targeting ZMYND8 unleashes IL-2 signalling to override T cell exhaustion. Nature (2026). https://doi.org/10.1038/s41586-026-11059-5

Download citation

  • Received:

  • Accepted:

  • Published:

  • Version of record:

  • DOI: https://doi.org/10.1038/s41586-026-11059-5